CLEC1B (NM_016509) Human Untagged Clone
CAT#: SC122848
CLEC1B (untagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1
CNY 2640.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_016509, the custom clone sequence may differ by one or more nucleotides
ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGTTGGCT CTGCATCCTCCTCCTGGTGGCGTGTGATGGCTTTGATTCTGCTGATCCTGTGCGTGGGGATGGTTGTCGG GCTGGTGGCTCTGGGGATTTGGTCTGTCATGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACA GGAACTCTGCAACAATTAGCAAAGCGCTTCTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTT TCAAAGGTCATAAATGCAGCCCCTGTGACACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTT CAGGCACAACTTAACATGGGAAGAGAGTAAGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATT GACAACCGGAACATTGTGGAGTACATCAAAGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCC AGAAGTCGAATGAGGTCTGGAAGTGGGAGGATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGA AGATGGAAAAGGAAATATGAATTGTGCTTATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAAC AAACATTATTTAATGTGTGAGAGGAAGGCTGGCATGACCAAGGTGGACCAACTACCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_016509 |
| Insert Size | 945 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016509.2, NP_057593.2 |
| RefSeq Size | 963 bp |
| RefSeq ORF | 690 bp |
| Locus ID | 51266 |
| UniProt ID | Q9P126 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217091 | CLEC1B (Myc-DDK-tagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1 |
CNY 3990.00 |
|
| RC217091L3 | Lenti-ORF clone of CLEC1B (Myc-DDK-tagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1 |
CNY 5890.00 |
|
| RC217091L4 | Lenti-ORF clone of CLEC1B (mGFP-tagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1 |
CNY 5890.00 |
|
| RG217091 | CLEC1B (tGFP-tagged) - Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 1 |
CNY 4370.00 |
