DUOXA1 (NM_144565) Human Untagged Clone
CAT#: SC123168
DUOXA1 (untagged)-Human dual oxidase maturation factor 1 (DUOXA1)
CNY 5488.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | mol; NIP; NUMBIP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_144565 edited
CTTCCAGCGGACGGCAGCGCGCGAGACCAGGCCAGGCGTCAAAGCAAGTCACCCATCCGA CCTAAACCCCTCTAAGACCCTGGAGTCACGTCTCCCTCCGGGGATCCTCGTGAGGTCTTG GGGGTCCCACCGCCCTGCGAGCCGCGCCCGCGCCCCGCCAGACCCGGAACTGCGTCGCTA GAACGTCGGGACCTGGTTCCCTCTTTAATCACACCCCCGGGGGCGCTTCGTGTGAGGTTC CACGGGGGAAGGCGAGAGGCGCAGGCTGCCACACACGCACTGTTTGGAAGAGGGGAAGGG CTGCACTTCCTGCTTTCATCCAGACCAAGTTCGGATCAAGTGGGAGTTCTTCAAAGAGAG AGTTTGCATTGCCCCCCCTGCACCACCTCACCAAGATGGCTACTTTGGGACACACATTCC CCTTCTATGCTGGCCCCAAGCCAACCTTCCCGATGGACACCACTTTGGCCAGCATCATCA TGATCTTTCTGACTGCACTGGCCACGTTCATCGTCATCCTGCCTGGCATTCGGGGAAAGA CGAGGCTGTTCTGGCTGCTTCGGGTGGTGACCAGCTTATTCATCGGGGCTGCAATCCTGG GGACCCCCGTGCAGCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCC TGGGTGAGAACTATGCTGAGGAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTG TGTTGTACCTAGCTGAGAAGTTCACTCCAAGAAGCCCATGTGGCCTATACCGCCAGTACC GCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGCATTCCTCTGCTGGCTGCTGG CCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTATTGGCCACGG GCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCT GTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCA CATTGACCACAGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGA TGCAGCCTCACAGGCTGAAGGCTTTCTTCAACCAGAGTGTGGATGAAGACCCCATGCTGG AGTGGAGTCCTGAGGAAGGTGGACTCCTGAGCCCCCGCTACCGGTCCATGGCTGACAGTC CCAAGTCCCAGGACATTCCCCTGTCAGAGGCTTCCTCCACCAAGGCATACTGTAAGGAGG CACACCCCAAAGATCCTGATTGTGCTTTATAACATTCCTCCCCGTGGAGGCCACCTGGAC TTCCAGTCTGGCTCCAAACCTCATTGGCGCCCCATAAAACCAGCAGAACTGCCCTCAGGG TGGCTGTTACCAGACACCCAGCACCAATCTACAGACGGAGTAGAAAAAGGAGGCTCTATA TACTGATGTTAAAAAACAAAACAAAACAAAAAGCCCTAAGGGACTGAAGAGATGCTGGGC CTGTCCATAAAGCCTGTTGCCATGATAAGGCCAAGCAGGGGCTAGCTTATCTGCACAGCA ACCCAGCCTTTCCGTGCTGCCTTGCCTCTTCAAGATGCTATTCACTGAAACCTAACTTCA CCCCCATAACACCAGCAGGGTGGGGGTTACATATGATTCTCCTATGGTTTCCTCGCAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | Please inquire |
| ACCN | NM_144565 |
| Insert Size | 1706 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_144565.2, NP_653166.2 |
| RefSeq Size | 1923 bp |
| RefSeq ORF | 1452 bp |
| Locus ID | 90527 |
| UniProt ID | Q1HG43 |
| Protein Families | Transmembrane |
| Gene Summary | Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (1) encodes the longest isoform (1, also known as gamma). Variants 1 and 2 encode the same isoform 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
NIP1/DUOXA1 expression in epithelial breast cancer cells: regulation of cell adhesion and actin dynamics
,Elena A. Ostrakhovitch and Shawn S. C. Li,
Breast Cancer Res Treat DOI 10.1007/s10549-009-0372-7
[DUOXA1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206754 | DUOXA1 (Myc-DDK-tagged)-Human dual oxidase maturation factor 1 (DUOXA1) |
CNY 5488.00 |
|
| RC206754L3 | Lenti ORF clone of Human dual oxidase maturation factor 1 (DUOXA1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC206754L4 | Lenti ORF clone of Human dual oxidase maturation factor 1 (DUOXA1), mGFP tagged |
CNY 5890.00 |
|
| RG206754 | DUOXA1 (tGFP-tagged) - Human dual oxidase maturation factor 1 (DUOXA1) |
CNY 7088.00 |

