RUNX1T1 (NM_175636) Human Untagged Clone
CAT#: SC123341
RUNX1T1 (untagged)-Human runt-related transcription factor 1, translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 4
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AML1-MTG8; AML1T1; CBFA2T1; CDR; ETO; MTG8; ZMYND2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_175636 edited
GGGGAGGTAAATGTATCCATAGACCACAGTGCCTTGCTTTTTCCTCTGCCAGCACATGGA GCACGGGATTAGATGCACAAACCTATTTAGGGAACTATTTTGGTAGATGTTTGAGTTTAT ACAGAAATTGCAGCTGGTATTTTATTTTGCTGTACATTTACTCAACTTGTCCATTAGTAT TTAACTATTTCCAGAGTTTGTTTAGGAGTAAGAATTGACCCATTCGTTAGTTTACCATAT TTTTTCCTGGTATAAAAAGGAGCCAGAAATAAGCCTTATTGCTAAATAATTAATTATGTA AGCCCACCTAGGTCCTGCATAAGATCCCCCTCACATACTTCACAATATATATGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTATTTGGCTAAAAAATTATACTG CCAAAATTACTGATTATAAATACTTGACTACACTGATTGATGGGACAAAATGATTAAAGT ATTTTCAGGGATCTTATTCCATATGTCACCACCAAAGATTTCTACAGTGTTATAAAGTAT ATAAATATTCCAAATTTCTGTGGTTAAATATTTTTTTCTTTTTTTTCCTTTTTTAGAATA ACACAGTCTGTGCTTTCCAAAAATGCTTGAACTTTTATGTTGTTAAAGAAATATATAATG ATATCTTACATTAAGCATGAGTCTAATTTGTATTAATTGGGATGGACTAAATTTTCATTT GATTATCAGGAAAATTAAGGAGTTATATATTTAAAAGCAATTTTCTGTGTTTTCTTCTTT GTAAGTTGACTCATTTGTGAAGCAATTAGGCAAATTTTGAGAAGATCATTGTTATTGTGG TTTGCAGTATATATTTCTTAGTAAATATCACTTAAGATTAAATTTTTCAGAAAGAAAATT ATAGCTTTTTTCCCAAAATATTTTTAAGATTTAATCTTTTTGTAGTATGCTACAGATTTA ATTATATTAACTCTTTTTTAAGACATTGACCATGACTTAACATTTTGCCTTCTAACACCT TTTAAATCTATGTACTTTAATAGTTAAGAGAAAATAAGTTTGCAGATTTTTAATAATCTG TTTGTAAAAGGCTATCTCTAAGCCTAGTATGTGGGTAATTTTACAGGTGTGTTTTTTGAT AACTTTAATATAAAATAAACTCATTTTATTTGTGCCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_175636 |
Insert Size | 1206 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175636.1, NP_783554.1 |
RefSeq Size | 3362 bp |
RefSeq ORF | 1704 bp |
Locus ID | 862 |
UniProt ID | Q06455 |
Protein Families | Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Pathways in cancer |
Gene Summary | This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (4) utilizes an alternate exon in the 5' UTR and coding region compared to variant 1, resulting in translation initiation from a downstream ATG. The resulting protein (isoform C, also known as MTG8c) has a shorter N-terminus compared to isoform A. Variants 3 and 4 both encode isoform C. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200898 | RUNX1T1 (Myc-DDK-tagged)-Human runt-related transcription factor 1, translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 4 |
CNY 4224.00 |
|
RC200898L3 | Lenti ORF clone of Human runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC200898L4 | Lenti ORF clone of Human runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RG200898 | RUNX1T1 (tGFP-tagged) - Human runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 4 |
CNY 5824.00 |
其它RUNX1T1产品