RNF21 (TRIM34) (NM_021616) Human Untagged Clone
CAT#: SC124362
TRIM34 (untagged)-Human tripartite motif containing 34 (TRIM34), transcript variant 1
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IFP1; RNF21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_021616, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCAAAAATCTTGCTTAACGTACAAGAGGAGGTGACCTGTCCCATCTGCCTGGAGCTGTTGACAG AACCCTTGAGTCTAGACTGTGGCCACAGCCTCTGCCGAGCCTGCATCACTGTGAGCAACAAGGAGGCAGT GACCAGCATGGGAGGAAAAAGCAGCTGTCCTGTGTGTGGTATCAGTTACTCATTTGAACATCTACAGGCT AATCAGCATCTGGCCAACATAGTGGAGAGACTCAAGGAGGTCAAGTTGAGCCCAGACAATGGGAAGAAGA GAGATCTCTGTGATCATCATGGAGAGAAACTCCTACTCTTCTGTAAGGAGGATAGGAAAGTCATTTGCTG GCTTTGTGAGCGGTCTCAGGAGCACCGTGGTCACCACACAGTCCTCACGGAGGAAGTATTCAAGGAATGT CAGGAGAAACTCCAGGCAGTCCTCAAGAGGCTGAAGAAGGAAGAGGAGGAAGCTGAGAAGCTGGAAGCTG ACATCAGAGAAGAGAAAACTTCCTGGAAGTATCAGGTACAAACTGAGAGACAAAGGATACAAACAGAATT TGATCAGCTTAGAAGCATCCTAAATAATGAGGAGCAGAGAGAGCTGCAAAGATTGGAAGAAGAAGAAAAG AAGACGCTGGATAAGTTTGCAGAGGCTGAGGATGAGCTAGTTCAGCAGAAGCAGTTGGTGAGAGAGCTCA TCTCAGATGTGGAGTGTCGGAGTCAGTGGTCAACAATGGAGCTGCTGCAGGACATGAGTGGAATCATGAA ATGGAGTGAGATCTGGAGGCTGAAAAAGCCAAAAATGGTTTCCAAGAAACTGAAGACTGTATTCCATGCT CCAGATCTGAGTAGGATGCTGCAAATGTTTAGAGAACTGACAGCTGTCCGGTGCTACTGGGTGGATGTCA CACTGAATTCAGTCAACCTAAATTTGAATCTTGTCCTTTCAGAAGATCAGAGACAAGTGATATCTGTGCC AATTTGGCCTTTTCAGTGTTATAATTATGGTGTCTTGGGATCCCAATATTTCTCCTCTGGGAAACATTAC TGGGAAGTGGACGTGTCCAAGAAAACTGCCTGGATCCTGGGGGTATACTGTAGAACATATTCCCGCCATA TGAAGTATGTTGTTAGAAGATGTGCAAATCGTCAAAATCTTTACACCAAATACAGACCTCTATTTGGCTA CTGGGTTATAGGGTTACAGAATAAATGTAAGTATGGTGTCTTTGAAGAGTCTTTGTCCTCTGATCCCGAG GTTTTGACTCTCTCCATGGCTGTGCCTCCCTGCCGTGTTGGGGTTTTCCTCGACTATGAAGCAGGCATTG TCTCATTTTTCAATGTCACAAGCCATGGCTCCCTCATTTACAAGTTCTCTAAATGTTGCTTTTCTCAGCC TGTTTATCCATATTTCAATCCTTGGAACTGTCCAGCTCCCATGACTCTATGCCCACCAAGCTCTTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_021616 |
| Insert Size | 2500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021616.4, NP_067629.2 |
| RefSeq Size | 2302 bp |
| RefSeq ORF | 1467 bp |
| Locus ID | 53840 |
| UniProt ID | Q9BYJ4 |
| Domains | zf-B_box, RING, SPRY |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. Expression of this gene is up-regulated by interferon. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from the upstream TRIM6 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the longer isoform (1, also known as the middle form). Both variants 1 and 4 encode the same isoform. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218306 | TRIM34 (Myc-DDK-tagged)-Human tripartite motif containing 34 (TRIM34), transcript variant 1 |
CNY 3656.00 |
|
| RC218306L1 | Lenti ORF clone of Human tripartite motif containing 34 (TRIM34), transcript variant 1, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC218306L2 | Lenti ORF clone of Human tripartite motif containing 34 (TRIM34), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC218306L3 | Lenti ORF clone of Human tripartite motif containing 34 (TRIM34), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218306L4 | Lenti ORF clone of Human tripartite motif containing 34 (TRIM34), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG218306 | TRIM34 (tGFP-tagged) - Human tripartite motif containing 34 (TRIM34), transcript variant 1 |
CNY 5256.00 |
