MAX (NM_145113) Human Untagged Clone
CAT#: SC124537
MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 3
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHd4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC111653 sequence for NM_002382 edited (data generated by NextGen Sequencing)
ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCT GCGGCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAA GACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAGGCATCCCGG GCCCAAATCCTAGACAAAGCCACAGAATATATCCAGTATATGCGAAGGAAAAACCACACA CACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAGCAAGTCCGT GCACTGGAGAAGGCGAGGTCAAGTGCCCAACTGCAGACCAACTACCCCTCCTCAGACAAC AGCCTCTACACCAACGCCAAGGGCAGCACCATCTCTGCCTTCGATGGGGGCTCGGACTCC AGCTCGGAGTCTGAGCCTGAAGAGCCCCAAAGCAGGAAGAAGCTCCGGATGGAGGCCAGC TAA Clone variation with respect to NM_002382.3 |
Restriction Sites | NotI-NotI |
ACCN | NM_145113 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145113.1, NP_660088.1 |
RefSeq Size | 2169 bp |
RefSeq ORF | 312 bp |
Locus ID | 4149 |
UniProt ID | P61244 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | MAPK signaling pathway, Pathways in cancer, Small cell lung cancer |
Gene Summary | The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) uses an alternate in-frame exon in the 3' coding region compared to variant 1. The resulting protein (isoform c) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220343 | MAX (Myc-DDK-tagged)-Human MYC associated factor X (MAX), transcript variant 3 |
CNY 1200.00 |
|
RC220343L3 | Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC220343L4 | Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG220343 | MAX (tGFP-tagged) - Human MYC associated factor X (MAX), transcript variant 3 |
CNY 2800.00 |