DIO2 (NM_013989) Human Untagged Clone
CAT#: SC124708
DIO2 (untagged)-Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 5808.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Synonyms | 5DII; D2; DIOII; SELENOY; SelY; TXDI2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_013989, the custom clone sequence may differ by one or more nucleotides
ATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTCT TCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCCAC TCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGAT GCCTACAAACAGGTGAAATTGGGTGAGGATGCCCCCAATTCCAGTGTGGTGCATGTCTCCAGTACAGAAG GAGGTGACAACAGTGGCAATGGTACCCAGGAGAAGATAGCTGAGGGAGCCACATGCCACCTTCTTGACTT TGCCAGCCCTGAGCGCCCACTAGTGGTCAACTTTGGCTCAGCCACTTGACCTCCTTTCACGAGCCAGCTG CCAGCCTTCCGCAAACTGGTGGAAGAGTTCTCCTCAGTGGCTGACTTCCTGCTGGTCTACATTGATGAGG CTCATCCATCAGATGGCTGGGCGATACCGGGGGACTCCTCTTTGTCTTTTGAGGTGAAGAAGCACCAGAA CCAGGAAGATCGATGTGCAGCAGCCCAGCAGCTTCTGGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTT GTGGCTGACCGCATGGACAATAACGCCAACATAGCTTACGGGGTAGCCTTTGAACGTGTGTGCATTGTGC AGAGACAGAAAATTGCTTATCTGGGAGGAAAGGGCCCCTTCTCCTACAACCTTCAAGAAGTCCGGCATTG GCTGGAGAAGAATTTCAGCAAGAGATGAAAGAAAACTAGATTAGCTGGTTAA >OriGene 5' read for NM_013989 unedited
GTAGAATTAGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGAGAGAACTAG TCTCGAGTTTTTTTTTTTTTTTTTTTTTCCCCTAAATGGTATGGCCAAAAGTCAGAGTTA AAATATATATAGTTAGATTCCAACTTCCTCCTTCACTCTAAAAATAGAATCCAAACCCAC TCTTCATATATGCTTCCAGAATGGGGCTTAAGTACCAATCTCTGCTTTGCAATGGGCACA ATCTTGGTCATGTCCTGAGGCTCTCTAAGAAAAGAGAGGATCTAGGATGGGAGAGCTAGA AAGTTGCTAACTGGGAAGAACAAGGCCCTGAGGGCTTGGTCTACCAATCTGGGAAGATTT GAAAACAAACTTCTCGCAACTGAAGGAAGGCTGAAGGCTGCTGCAAGTCATTGAGTGACT TTAGGATGAGCAAAACATTGGGCCACTTCCTAATGCCCTATGTGTATAGTACCAGAAGCA AGGTCTCAGACTTAACAGACCCAGCTCTGTTCCAAGGTGAGTCTGAACCAATAGAAAGCA AACATGTGCAGATATCCAAACAAGACTGCTCATGCAAGTCGGGGCTGGCTACCCGTCTTA GGCAGCAACAGCAGAGCTCCAGGGAGCTTATTCAATATTTACTGAGACTTCGAAGACCCA GCAGATGTTTAATGAAGTCACTATTTTGGCTCAAACCCTCCACTTCTCCCCCTCCCCTCA AAAAGCCAACAGGTAAACACATAAATGAAAGAAACCCACAGAAGGGGATGGGAAATAAGA AAATTCTCTCAAGACTTNCTCCAGGCCATGTCACTGGTCAGCGTGGTTTTTATGTGTATT AGGGATGGGGGATGTGAAGAAATAGTATCCAGTCCTTTATAACCAAGCANTAAATGATAT GGGTAGGGAATGTNGGCCAGNTTNNGTTAGTTTGCATCACATGTCCCAGACTACTAGCCC AGTATC |
Restriction Sites | NotI-NotI |
ACCN | NM_013989 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013989.2, NP_054644.1 |
RefSeq Size | 6703 bp |
Locus ID | 1734 |
UniProt ID | Q92813 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is widely expressed, including in thyroid and brain. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. It has also been reported to be highly expressed in thyroids of patients with Graves disease, and in follicular adenomas. The intrathyroidal T4 to T3 conversion by this enzyme may contribute significantly to the relative increase in thyroidal T3 production in these patients. This protein is a selenoprotein containing the non-standard amino acid, selenocysteine (Sec), which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Unlike the other two members (DIO1 and DIO3) of this enzyme family, the mRNA for this gene contains an additional in-frame UGA codon that has been reported (in human) to function either as a Sec or a stop codon, which can result in two isoforms with one or two Sec residues; however, only the upstream Sec (conserved with the single Sec residue found at the active site in DIO1 and DIO3) was shown to be essential for enzyme activity (PMID:10403186). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2018] Transcript Variant: This variant (1, also known as hDII-a) represents the predominant transcript and encodes two isoforms resulting from the use of alternative in-frame translation termination codons. The shorter isoform (b) with one Sec residue results from translation termination at the second UGA codon, while the longer isoform (a) with two Sec residues results from translation termination at an in-frame downstream UAA stop codon. This RefSeq represents the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214679 | DIO2 (Myc-DDK-tagged)-Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 3600.00 |
|
RC214679L1 | Lenti-ORF, DIO2 (Myc-DDK-tagged)-Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) |
CNY 6000.00 |
|
RC214679L3 | Lenti-ORF, DIO2 (Myc-DDK-tagged)-Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) |
CNY 6000.00 |
|
RC214679L4 | Lenti-ORF, DIO2 (mGFP-tagged) - Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1, (Note: selenocystein protein, Internal stop codon present. See Summary below) |
CNY 6000.00 |
|
RG214679 | DIO2 (GFP-tagged) - Human deiodinase, iodothyronine, type II (DIO2), transcript variant 1, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 5200.00 |