GNG13 (NM_016541) Human Untagged Clone

CAT#: SC125264

GNG13 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 13 (GNG13)



  "NM_016541" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G(gamma)13; h2-35
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC125264 sequence for NM_016541 edited (data generated by NextGen Sequencing)
ATGGAGGAGTGGGACGTGCCACAGATGAAGAAAGAGGTGGAGAGCCTTAAGTACCAGCTG
GCCTTCCAGCGGGAGATGGCGTCCAAGACCATCCCCGAGCTGCTGAAGTGGATCGAGGAC
GGGATCCCCAAGGACCCCTTCCTGAACCCCGACCTGATGAAGAACAACCCATGGGTGGAA
AAGGGCAAATGCACCATCCTGTGA

Clone variation with respect to NM_016541.2
48 c=>t
>OriGene 5' read for NM_016541 unedited
TACTATAGGGCGGCCGCGAATTCCCTGACCTCATGGAGGAGTGGGACGTGCCACAGATGA
AGAAAGAGGTGGAGAGCCTTAAGTACCAGCTGGCCTTCCAGCGGGAGATGGCGTCCAAGA
CCATCCCCGAGCTGCTGAAGTGGATCGAGGACGGGATCCCCAAGGACCCCTTCCTGAACC
CCGACCTGATGAAGAACAACCCATGGGTGGAAAAGGGCAAATGCACCATCCTGTGAGCCC
CTCGAGCGGAGAAGGGCGAATTCAGATCTGGTACCGATATCAAGCTTGTCGACTCTAGAT
TGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTC
CCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAAT
AAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAG
GGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTA
TTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTG
GGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGAC
CAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCT
GGTCTNCCAACTCTA
Restriction Sites Please inquire     
ACCN NM_016541
Insert Size 230 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016541.1, NP_057625.1
RefSeq Size 980 bp
RefSeq ORF 204 bp
Locus ID 51764
UniProt ID Q9P2W3
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Taste transduction
Gene Summary Heterotrimeric G proteins, which consist of alpha (see MIM 139320), beta (see MIM 139380), and gamma subunits, function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. GNG13 is a gamma subunit that is expressed in taste, retinal, and neuronal tissues and plays a key role in taste transduction (Li et al., 2006 [PubMed 16473877]).[supplied by OMIM, Oct 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...