MT ATP6 (ATP6) (NM_173702) Human Untagged Clone

CAT#: SC126708

MTATP6 (untagged)-Human ATP synthase 6 (MTATP6). Note: ORF is codon optimized



CNY 6270.00


货期*
3周

规格
    • 10 ug

Cited in 3 publications.

Product images

推荐一起购买 (4)
MT-ATP6 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC126708 representing NM_173702.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGAAAACCTGTTCGCGTCTTTTATCGCGCCGACCATTCTGGGTCTGCCGGCTGCGGTACTGATC
ATTCTGTTTCCGCCGCTGCTGATCCCGACCTCTAAATATCTGATTAACAACCGTCTGATCACCACTCAG
CAGTGGCTGATCAAACTGACTTCTAAACAGATGATGACCATGCATAACACCAAAGGTCGTACCTGGTCT
CTGATGCTGGTTTCCCTGATCATCTTCATCGCGACTACTAACCTGCTGGGCCTGCTGCCGCACTCTTTC
ACCCCGACTACCCAGCTGTCCATGAACCTGGCGATGGCGATTCCGCTGTGGGCGGGTACCGTTATCATG
GGTTTCCGTTCTAAAATCAAAAACGCGCTGGCGCACTTCCTGCCGCAGGGCACTCCGACCCCGCTGATT
CCGATGCTGGTAATTATCGAAACCATCTCCCTGCTGATCCAGCCGATGGCACTGGCGGTTCGTCTGACT
GCGAACATTACTGCGGGTCATCTGCTGATGCACCTGATTGGTTCTGCTACTCTGGCTATGAGCACCATC
AACCTGCCGTCTACCCTGATTATCTTTACCATCCTGATTCTGCTGACTATCCTGGAAATCGCGGTTGCA
CTGATTCAGGCGTACGTGTTTACTCTGCTGGTGTCCCTGTACCTGCACGACAACACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_173702
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_173702.1
RefSeq Size 843 bp
RefSeq ORF 681 bp
Locus ID 4508
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 24.8 kDa
Gene Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Key component of the proton channel; it may play a direct role in the translocation of protons across the membrane. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (3)

Customer Reviews 
Loading...