Protein kinase Y linked (PRKY) (NM_002760) Human Untagged Clone

CAT#: SC126856

PRKY (untagged)-Human protein kinase, Y-linked (PRKY)



  "NM_002760" in other vectors (7)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-PRKY mouse monoclonal antibody, clone OTI3E10 (formerly 3E10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OTTHUMP00000033227; protein kinase, Y-linked
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002760 edited
GGACCTGAGTGCCTCCCCATGGAGGCGCCCGGGCCGGCCCAGGCGGCCGCGGCGGAGAGC
AACTCCCGAGAGGTGACGGAGGATGCCGCCGACTGGGCGCCCGCGCTCTGCCCCAGCCCC
GAGGCGCGGTCGCCGGAGGCGCCTGCCTACCGCCTGCAGGACTGCGACGCGCTGGTCACC
ATGGGCACTGGGACGTTCGGGCGGGTGCACCTGGTGAAGGAGAAGACAGCCAAGCATTTC
TTCGCCCTCAAGGTGATGAGCATTCCCGACGTCATCCGCCGGAAGCAGGAGCAGCACGTG
CACAATGAGAAGTCTGTCCTGAAGGAAGTCAGCCACCCGTTCCTCATCAGGCTGTTCTGG
ACGTGGCATGAGGAGCGCTTCCTCTACATGCTCATGGAGTATGTGCCGGGTGGCGAGCTC
TTCAGCTACCTGCGCAACCGGGGGCACTTCTCCAGCACCACGGGGCTCTTCTACTCTGCG
GAGATCATCTGTGCCATTGAGTACCTGCACTCCAAGGAGATCGTCTACAGGGATTTGAAG
CCGGAGAACATCCTGCTGGATAGGGATGGTCACATCAAGCTCACGGACTTTGGGTTTGCC
AAGAAGCTGGTAGACAGGACTTGGACCCTCTGTGGAACACCCGAGTACCTAGCCCCCGAA
GTCATTCAGAGCAAGGGCCACGGAAGGGCCGTGGACTGGTGGGCCCTCGGCATCCTGATA
TTCGAGATGCTTTCGGGGTTTCCTCCATTTTTTGATGACAACCCGTTTGGCATTTATCAG
AAAATTCTTGCAGGCAAACTATATTTCCCCAGACATTTGGATTTCCATGTAAAAACGGGG
CGAATGATGTGAAACACCATCGGTGGTTCCGCTCCGTGGACTGGAAAGCTGTTCC
Restriction Sites Please inquire     
ACCN NM_002760
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002760.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002760.2, NP_002751.1
RefSeq Size 7228 bp
RefSeq ORF 834 bp
Locus ID 5616
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene is similar to the protein kinase, X-linked gene in the pseudoautosomal region of the X chromosome. The gene is classified as a transcribed pseudogene because it has lost a coding exon that results in all transcripts being candidates for nonsense-mediated decay (NMD) and unlikely to express a protein. Abnormal recombination between this gene and a related gene on chromosome X is a frequent cause of XX males and XY females. [provided by RefSeq, Jul 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...