ZMPSTE24 (NM_005857) Human Untagged Clone

CAT#: SC127925

ZMPSTE24 (untagged)-Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24)



  "NM_005857" in other vectors (6)

CNY 11016.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
ZMPSTE24 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FACE-1; FACE1; HGPS; PRO1; STE24; Ste24p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_005857, the custom clone sequence may differ by one or more nucleotides


ATGGGGATGTGGGCATCGCTGGACGCTTTGTGGGAGATGCCGGCCGAGAAGCGTATCTTCGGGGCCGTGC
TGCTCTTTTCCTGGACAGTGTATCTTTGGGAGACCTTCCTAGCACAGCGGCAGAGAAGGATATATAAAAC
AACAACTCATGTACCACCGGAGTTAGGACAGATCATGGATTCTGAAACATTTGAGAAATCTCGACTCTAT
CAACTGGATAAAAGCACTTTCAGCTTCTGGTCAGGACTCTATTCAGAGACTGAAGGCACTCTTATTCTTC
TCTTTGGAGGAATACCTTATCTCTGGAGACTTTCTGGACGGTTCTGTGGTTATGCTGGCTTTGGACCAGA
ATATGAGATCACTCAGTCCCTGGTGTTTCTGCTGTTGGCTACACTTTTCAGTGCATTGACTGGTTTGCCA
TGGAGTCTTTATAATACTTTTGTGATAGAAGAAAAACATGGCTTCAATCAACAGACTTTGGGGTTCTTCA
TGAAAGATGCAATCAAGAAATTTGTTGTGACTCAGTGTATTTTGTTGCCTGTGTCTTCACTTCTACTTTA
CATTATTAAAATTGGGGGTGACTATTTTTTTATTTATGCCTGGCTGTTCACATTAGTTGTGTCTCTGGTT
CTTGTCACAATCTATGCTGATTATATTGCCCCTTTATTTGACAAATTCACACCTCTGCCTGAGGGAAAGC
TTAAAGAAGAAATTGAAGTAATGGCAAAGAGTATTGACTTTCCTTTGACGAAGGTGTATGTTGTGGAAGG
ATCTAAACGCTCTTCCCACAGCAATGCTTATTTTTATGGCTTCTTCAAGAACAAGCGAATAGTTTTGTTT
GACACTCTACTAGAAGAGTACTCTGTACTAAACAAAGACATCCAGGAGGATTCTGGCATGGAACCCCGCA
ATGAGGAAGAAGGGAACAGTGAAGAAATAAAAGCTAAAGTTAAAAATAAGAAACAAGGATGTAAAAATGA
GGAGGTACTCGCTGTACTAGGCCATGAACTGGGGCACTGGAAGTTGGGACATACAGTCAAAAATATCATT
ATTAGCCAGATGAATTCTTTCCTGTGTTTTTTTTTATTTGCTGTATTAATTGGTCGAAAGGAGCTTTTTG
CTGCATTTGGTTTTTATGATAGCCAACCCACTCTTATTGGACTATTGATCATCTTCCAGTTTATTTTTTC
ACCTTACAATGAGGTTCTTTCTTTTTGCCTAACAGTCCTAAGCCGCAGATTTGAGTTTCAAGCTGATGCA
TTTGCCAAGAAACTTGGGAAGGCTAAAGACTTATATTCTGCTTTAATCAAACTTAACAAAGATAACTTGG
GATTCCCTGTTTCTGACTGGTTGTTCTCAATGTGGCATTATTCTCATCCTCCACTGCTAGAGAGACTTCA
AGCTTTGAAAACTATGAAGCAACACTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites NotI-NotI     
ACCN NM_005857
Insert Size 2820 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005857.2, NP_005848.2
RefSeq Size 3165 bp
RefSeq ORF 3165 bp
Locus ID 10269
UniProt ID O75844
Domains Peptidase_M48
Protein Families Druggable Genome, Protease, Transmembrane
Gene Summary This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...