hCG beta (CGB3) (NM_000737) Human Untagged Clone

CAT#: SC300128

CGB (untagged)-Human chorionic gonadotropin, beta polypeptide (CGB)



  "NM_000737" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
CGB mouse monoclonal antibody, clone OTI2A3 (formerly 2A3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGB; CGB5; CGB7; CGB8; hCGB; LHB
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000737 edited
GCCTCCTCCTGGCTTCCAAGACCCCACCATAGGCAGAGGCAGGCCTTCCTACACCCTACT
CCCTGTGCCTCCAGCCTCGACTAGTCCCTAGCACTCGACGACTGAGTCTCTGAGGTCACT
TCACCGTGGTCTCCGCCTCACCCTTGGCGCTGGACCACTGAGGGGAGAGGGCTGGGGCGC
TCCGCTGAGCCACTCCTGAGCCCCCCTGGCCTTGTCTACCTCTTGCCCCCCAAGGGGTTA
GTGTCGAGCTCACCCCAGCATCCTACCACCTCCTGGTGGCCTTGCCGCCCCCACAACCCC
GAGGTATAAAGCCAGGTACACGAGGCAGGGGACGCACCAAGGATGGAGATGTTCCAGGGG
CTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTTCGG
CCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGC
ATCACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAG
GGGGTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCC
ATCCGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTC
AGCTGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGTCCCAAGGACCAC
CCCTTGACCTGTGATGACCCCCGCTTCCAGGACTCCTCTTCCTCAAAGGCCCCTCCCCCG
AGCCTTCCAAGTCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATAA
AGGCTTCTCAATCCGCAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000737
Insert Size 900 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000737.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000737.2, NP_000728.1
RefSeq Size 879 bp
RefSeq ORF 498 bp
Locus ID 1082
UniProt ID P01233
Protein Families Druggable Genome
Gene Summary This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...