GnRH (GNRH1) (NM_000825) Human Untagged Clone

CAT#: SC300137

GNRH1 (untagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 1



  "NM_000825" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-GNRH1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GNRH; GRH; LHRH; LNRH
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000825 edited
CCCACAGATGGTTCAGCCAGCAGTAATGCTAGGAAGACTGAAGGATAAATAGAAAAATGT
CATTAGTACCATGGGGTAGCCATGTAATGTCAAGCAATTTTATATTAGCCAGAGATTCCT
AGTAGGAGCTACTTTTCTTAACAGATGACTCAGTTCTCTTTATCTCAGGAATGAAAGAGT
TGAAGACCAATCCACAACAGGGGAAATGTTAAGGCAAAATGATGAACTTGATAAGGGATG
AATTATGGGGTTTGGATAACCAAACAATAAAAATAAAAGTATAGACTATTTTAGTACTAA
AAAGGTCCTGAACATGTGAGCTTAAGTACTCATTTTGTCCCCAGTGGCTAAGAAACTAAA
GGCAAGCCAGCAAGTGTCTCTGAGTTTCAGTGTCTGTATGTAAAAACTGACTCTGACTTC
CATCTTCTGCAGGGTTAGTGATACAGATGCTAGCTTTTTCACTAAAGAGGTCTTTTAGTT
TATACTCAACCTTGTCTGGATCTAATTTGATTGTGCATTCATGTGCCTTAGAATGAAGCC
AATTCAAAAACTCCTAGCTGGCCTTATTCTACTGACTTGGTGCGTGGAAGGCTGCTCCAG
CCAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGATGCCGAAAATTTGATTGA
TTCTTTCCAAGAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGCTTCGAATG
CACCACGCACCAGCCACGTTCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGAT
TGAAGAGGAAACTGGGCAGAAGAAGATTTAAATCCATTGGGCCAGAAGGAATGACCAT
Restriction Sites Please inquire     
ACCN NM_000825
Insert Size 800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000825.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000825.2, NP_000816.2
RefSeq Size 1512 bp
RefSeq ORF 279 bp
Locus ID 2796
Protein Families Druggable Genome, Secreted Protein
Protein Pathways GnRH signaling pathway
Gene Summary This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). This isoform (1) may undergo proteolytic processing similar to isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...