ACTH (POMC) (NM_000939) Human Untagged Clone
CAT#: SC300157
POMC (untagged)-Human proopiomelanocortin (POMC), transcript variant 2
CNY 6270.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACTH; CLIP; LPH; MSH; NPP; OBAIRH; POC |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000939 edited
CCGGGATGCGTCCCCGCCCTCAGAGAGCAGCCTCCCGAGACAGGGGTCCCACCAATCTTG TTTGCTTCTGCAGAGCCTCAGCCTGCCTGGAAGATGCCGAGATCGTGCTGCAGCCGCTCG GGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCCTCCATGGAAGTGCGTGGCTGGTGCCTG GAGAGCAGCCAGTGTCAGGACCTCACCACGGAAAGCAACCTGCTGGAGTGCATCCGGGCC TGCAAGCCCGACCTCTCGGCCGAGACTCCCATGTTCCCGGGAAATGGCGACGAGCAGCCT CTGACCGAGAACCCCCGGAAGTACGTCATGGGCCACTTCCGCTGGGACCGATTCGGCCGC CGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCAGGGCAGAAGCGCGAGGACGTCTCAGCG GGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGCCCCGAGCCCCGCAGCGATGGTGCCAAG CCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCG GTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTACCCTAACGGCGCCGAGGACGAGTCGGCC GAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTGACTGGCCAGCGACTCCGGGAGGGAGAT GGCCCCGACGGCCCTGCCGATGACGGCGCAGGGGCCCAGGCCGACCTGGAGCACAGCCTG CTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCCTACAGGATGGAGCACTTCCGCTGGGGC AGCCCGCCCAAGGACAAGCGCTACGGCGGTTTCATGACCTCCGAGAAGAGCCAGACGCCC CTGGTGACGCTGTTCAAAAACGCCATCATCAAGAACGCCTACAAGAAGGGCGAGTGAGGG CACAGCGGGGCCCCAGGGCTACCCTCCCCCAGGAGGTCGACCCCAAAGCCCCTTGCTCTC CCCTGCCCTGCTGCCGCCTCCCAGCCTGGGGGGTCGTGGCAGATAATCAGCCTCTTAAAG CTGCCTGTAGTTAGGAAATAAAACCTTTCAAATTTCAAAAAAAAAAAAAAAAAAAAAAAA AAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000939 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone is found to be a perfect match to NM_000939.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000939.2, NP_000930.1 |
| RefSeq Size | 1245 bp |
| RefSeq ORF | 804 bp |
| Locus ID | 5443 |
| UniProt ID | P01189 |
| Protein Families | Druggable Genome |
| Protein Pathways | Adipocytokine signaling pathway, Melanogenesis |
| Gene Summary | This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. Variants 1-4 encode the same protein. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A novel missense mutation in the signal peptide of the human POMC gene: a possible additional link between early-onset type 2 diabetes and obesity
,Monica Mencarelli1,3, Alessandra Zulian2,3, Raffaella Cancello1, Luisella Alberti2, Luisa Gilardini2, Anna Maria Di Blasio1 and Cecilia Invitti2,
European Journal of Human Genetics doi:10.1038/ejhg.2012.103
[POMC]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209619 | POMC (Myc-DDK-tagged)-Human proopiomelanocortin (POMC), transcript variant 2 |
CNY 2400.00 |
|
| RC209619L3 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC209619L4 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG209619 | POMC (tGFP-tagged) - Human proopiomelanocortin (POMC), transcript variant 2 |
CNY 4370.00 |
|
| SC322015 | POMC (untagged)-Human proopiomelanocortin (POMC), transcript variant 2 |
CNY 2400.00 |
