PRY (PRY2) (NM_001002758) Human Untagged Clone

CAT#: SC300442

PRY2 (untagged)-Human PTPN13-like, Y-linked 2 (PRY2)



  "NM_001002758" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PTPN13LY2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300442 representing NM_001002758.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGCCACTGGGCTTGGCTTTCTACTTTCCTGGAGACAAGACAATTTGAATGGCACTGACTGCCAG
GGATGCAATATTTTATACTTCTCTGAGACTACGGGGAGCATGTGTTCTGAACTTTCCTTGAACAGAGGT
CTTGAGGCCAGAAGGAAGAAGGATCTTAAAGACTCATTTCTCTGGAGATATGGGAAGGTTGGCTGTATC
TCACTTCCACTTCGTGAGATGACCGCCTGGATTAACCCACCCCAAATTTCAGAGATTTTCCAAGGCTAC
CACCAGAGGGTGCACGGAGCTGATGCACTGAGCCTGCAAACCAACTCTCTGAGAAGCAGGTTATCTTCA
CAGTGCCTCGGACAGAGCTTCCTTCTCAGGACACTCGAGAGAGGCCGTGGTTTCAGGGCACTTGGGGAC
ATCTGTGGCCACGTTCATGAAGAAGACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002758
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002758.1
RefSeq Size 1238 bp
RefSeq ORF 444 bp
Locus ID 442862
UniProt ID O14603
Protein Families Phosphatase
MW 16.5 kDa
Gene Summary This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. It encodes a protein which has a low degree of similarity to protein tyrosine phosphatase, non-receptor type 13. Two nearly identical copies of this gene exist within a palindromic region. This record represents the more centromeric copy. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...