SP140 (NM_001005176) Human Untagged Clone
CAT#: SC300816
SP140 (untagged)-Human SP140 nuclear body protein (SP140), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LYSP100; LYSP100-A; LYSP100-B |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001005176 edited
CTTTGACTGAGCACCGAGGGGCAGTTGGCAGCTTCACCTCAGAGCTGCAGGAAGGAACGG GGCAGTGAAAATCGAATCGGGTGTGATCCTAGGCCAAGCTCATGGCCCAGCAGGGCCAGC AGGGGCAGATGGCAAGTGGAGACAGCAATCTCAACTTCAGGATGGTCGCAGAGATCCAGA ACGTAGAGGGTCAGAACCTGCAGGAGCAGGTTTGCCCTGAGCCCATTTTCAGGTTCTTCA GAGAAAACAAGGTGGAGATTGCAAGTGCAATAACAAGGCCATTTCCTTTCCTTATGGGCC TCCGAGACCGCTCCTTCATCTCCGAGCAGATGTATGAACATTTTCAAGAAGCTTTTAGAA ACCTGGTCCCAGTGACAAGAGTGATGTATTGTGTACTCAGTGAACTGGAGAAGACATTTG GCTGGTCACATCTGGAAGCATTGTTCAGCAGGATTAACCTGATGGCCTATCCTGATTTAA ACGAGATTTACAGAAGCTTCCAGAATGAAAATTTATCATCCAGTGCAGTCCTGTGTCAAC TTGTTTCTCCAAACAAAGACTGGAGAAGTCACGAAGAGAGCCTAGCACATACTGGTACAC TGAGGAGGAGCTGCATGTGAAAGCTATGAAGACAGAAAAGGGGGTTGGTGGGGGCCTTTC CGAACCATGTGGTTGAATTGCAGACTGTGGGAGGCAGGGTGTGAGAGCTGACTCTGGAGA AAGAAGTTGAAGTGGATTCTGGAAGGCTTGACACCCTGTGCTAAGGAATCTGGAGTTTAA TTTTTGGAAAATAAAGAAGGAATAAAGGGCATTTAAACGGGAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001005176 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001005176.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001005176.1, NP_001005176.1 |
| RefSeq Size | 853 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 11262 |
| UniProt ID | Q13342 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) lacks multiple 3' exons, and has an alternate 3' sequence, as compared to variant 1. The encoded isoform 2 is much shorter and has a distinct C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215894 | SP140 (Myc-DDK-tagged)-Human SP140 nuclear body protein (SP140), transcript variant 2 |
CNY 2400.00 |
|
| RC215894L3 | Lenti ORF clone of Human SP140 nuclear body protein (SP140), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC215894L4 | Lenti ORF clone of Human SP140 nuclear body protein (SP140), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG215894 | SP140 (tGFP-tagged) - Human SP140 nuclear body protein (SP140), transcript variant 2 |
CNY 4370.00 |
