GOSR1 (NM_001007025) Human Untagged Clone
CAT#: SC301134
GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001007025 edited
CAAAGATGGCGGCAGGGACCAGCAGTTACTGGGAAGATCTCAGGAAACAGGCTCGACAGC TGGAAAATGAACTTGACCTGAAACTAGTTTCCTTCAGCAAACTATGTACAAGTTACAGTC ATAGCAGTACCCGAGATGGAAGACGCGACAGTTCTGATACAACACCCCTTTTAAATGGAT CAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGC TTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGA ATGCAGCCCTGATGCATACATTACAGCGGCATAGAGACATATTGCAGGATTATACACATG AATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGAT CAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAAGAACTG AGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACAA TAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAA TTCACAGCAAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGA GGATCAACCTGAGGAAGCGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTA CCATCCTGTTGCTGCTGTATGCGTTCCATTGATGGGACATCTTCAGGGACTCTTGACAGC CACCGCTTTCACACCCTGGTCTGGAATAAGGAAACATCGGAGGGAGAAGTTGACTGTCTT GATAATTAGCCTGACCAGCAGGATGAATGCAAGACTGACAGTGATGGACTCTGTGACATG GTCAGGTTGAGCTGAAGCCACAGTTTCTCTGTGCTGTGTTTTCTAACACATAATCTGTTT TTAATAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001007025 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007025.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001007025.1, NP_001007026.1 |
RefSeq Size | 5224 bp |
RefSeq ORF | 747 bp |
Locus ID | 9527 |
UniProt ID | O95249 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
Gene Summary | This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame small segment of 6 nts in the 5' coding region, as compared to variant 1. The encoded isoform 2 thus lacks internal 2 aa, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205913 | GOSR1 (Myc-DDK-tagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2 |
CNY 2400.00 |
|
RC205913L1 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC205913L2 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC205913L3 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC205913L4 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG205913 | GOSR1 (tGFP-tagged) - Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2 |
CNY 4370.00 |