DECTIN 2 (CLEC6A) (NM_001007033) Human Untagged Clone

CAT#: SC301138

CLEC6A (untagged)-Human C-type lectin domain family 6, member A (CLEC6A)



  "NM_001007033" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Mouse Monoclonal Dectin-2/CLEC6A Antibody (3D1)
    • 100 ug

CNY 5381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLEC4N; CLECSF10; dectin-2; hDECTIN-2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC301138 representing NM_001007033.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGCAAGAGCAGCAACCTCAAAGTACAGAGAAAAGAGGCTGGTTGTCCCTGAGACTCTGGTCTGTG
GCTGGGATTTCCATTGCACTCCTCAGTGCTTGCTTCATTGTGAGCTGTGTAGTAACTTACCATTTTACA
TATGGTGAAACTGGCAAAAGGCTGTCTGAACTACACTCATATCATTCAAGTCTCACCTGCTTCAGTGAA
GGGACAAAGGTGCCAGCCTGGGGATGTTGCCCAGCTTCTTGGAAGTCATTTGGTTCCAGTTGCTACTTC
ATTTCCAGTGAAGAGAAGGTTTGGTCTAAGAGTGAGCAGAACTGTGTTGAGATGGGAGCACATTTGGTT
GTGTTCAACACAGAAGCAGAGCAGAATTTCATTGTCCAGCAGCTGAATGAGTCATTTTCTTATTTTCTG
GGGCTTTCAGACCCACAAGGTAATAATAATTGGCAATGGATTGATAAGACACCTTATGAGAAAAATGTC
AGATTTTGGCACCTAGGTGAGCCCAATCATTCTGCAGAGCAATGTGCTTCAATAGTCTTCTGGAAACCT
ACAGGATGGGGCTGGAATGATGTTATCTGTGAAACTAGAAGGAATTCAATATGTGAGATGAATAAGATT
TACCTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001007033
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007033.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007033.1
RefSeq Size 1613 bp
RefSeq ORF 630 bp
Locus ID 93978
UniProt ID Q6EIG7
Protein Families Transmembrane
MW 24 kDa
Gene Summary The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...