CT45A5 (NM_001007551) Human Untagged Clone
CAT#: SC301242
CT45A5 (untagged)-Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT45-3; CT45-4; CT45-6; CT45.5; CT45A3; CT45A4; CT45A6; CT45A7; CT455 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301242 representing NM_001007551.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCGATAAAACAGAGAAGGTGGCTGTAGATCCTGAAACTGTGTTTAAACGTCCCAGGGAATGTGAC AGTCCTTCGTATCAGAAAAGGCAGAGGATGGCCCTGTTGGCAAGGAAACAAGGAGCAGGAGACAGCCTT ATTGCAGGCTCTGCCATGTCCAAAGAAAAGAAGCTTATGACAGGACATGCTATTCCACCCAGCCAATTG GATTCTCAGATTGATGACTTCACTGGTTTCAGCAAAGATGGGATGATGCAGAAACCTGGTAGCAATGCA CCTGTGGGAGGAAACGTTACCAGCAGTTTCTCTGGAGATGACCTAGAATGCAGAGAAACAGCCTCCTCT CCCAAAAGCCAACGAGAAATTAATGCTGATATAAAACGTAAATTAGTGAAGGAACTCCGATGCGTTGGA CAAAAATATGAAAAAATCTTCGAAATGCTTGAAGGAGTGCAAGGACCTACTGCAGTCAGGAAGCGATTT TTTGAATCCATCATCAAGGAAGCAGCAAGATGTATGAGACGAGACTTTGTTAAGCACCTTAAGAAGAAA CTGAAACGTATGATTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001007551 |
| Insert Size | 570 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007551.4 |
| RefSeq Size | 1321 bp |
| RefSeq ORF | 570 bp |
| Locus ID | 441521 |
| UniProt ID | Q6NSH3 |
| MW | 21.2 kDa |
| Gene Summary | This gene represents one of a cluster of several similar genes located on the q arm of chromosome X. The genes in this cluster encode members of the cancer/testis (CT) family of antigens, and are distinct from other CT antigens. These antigens are thought to be novel therapeutic targets for human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. COMPLETENESS: complete on the 3' end. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205570 | CT45A5 (Myc-DDK-tagged)-Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1 |
CNY 2400.00 |
|
| RC205570L3 | Lenti ORF clone of Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC205570L4 | Lenti ORF clone of Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG205570 | CT45A5 (tGFP-tagged) - Human cancer/testis antigen family 45, member A5 (CT45A5), transcript variant 1 |
CNY 4000.00 |
