IGFBPL1 (NM_001007563) Human Untagged Clone
CAT#: SC301247
IGFBPL1 (untagged)-Human insulin-like growth factor binding protein-like 1 (IGFBPL1)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA113O24.1; IGFBP-RP4; IGFBPRP4 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001007563 edited
ATGCCGCGCTTGTCTCTGCTCTTGCCGCTGCTGCTTCTGCTGCTGCTGCCGCTGCTGCCG CCGCTGTCCCCGAGCCTTGGGATCCGCGACGTGGGCGGCCGGCGCCCCAAGTGTGGTCCG TGCCGGCCAGAGGGCTGCCCGGCGCCTGCGCCCTGCCCGGCGCCCGGGATCTCGGCGCTC GACGAGTGCGGCTGCTGCGCCCGCTGCCTGGGAGCCGAGGGCGCGAGCTGCGGGGGCCGC GCCGGCGGGCGCTGTGGCCCCGGCCTGGTATGCGCGAGCCAGGCCGCTGGGGCAGCGCCC GAGGGCACCGGGCTCTGCGTGTGCGCGCAGCGCGGCACCGTCTGCGGCTCCGACGGTCGC TCGTACCCCAGCGTCTGCGCGCTGCGCCTGCGCGCTCGGCACACGCCCCGCGCGCACCCC GGTCACCTGCACAAGGCGCGCGACGGCCCTTGCGAGTTCGCTCCTGTGGTCGTCGTTCCT CCCCGAAGTGTTCACAACGTCACCGGGGCGCAGGTGGGCCTGTCCTGTGAAGTGAGGGCT GTGCCTACCCCAGTCATCACGTGGAGAAAGGTCACGAAGTCCCCTGAGGGCACCCAAGCA CTGGAGGAGCTGCCTGGGGACCATGTCAATATAGCTGTCCAAGTGCGAGGGGGCCCTTCT GACCATGAGGCCACGGCCTGGATTTTGATCAACCCCCTGCGAAAGGAGGATGAGGGTGTG TACCAGTGCCATGCAGCCAACATGGTGGGAGAGGCTGAGTCCCACAGCACAGTGACGGTT CTAGATCTGAGTAAATACAGGAGCTTCCACTTCCCAGCTCCCGATGACCGCATGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001007563 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007563.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007563.1, NP_001007564.1 |
| RefSeq Size | 1093 bp |
| RefSeq ORF | 837 bp |
| Locus ID | 347252 |
| UniProt ID | Q8WX77 |
| Gene Summary | IGF-binding proteins prolong the half-life of IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs in cell culture. They alter the interaction of IGFs with their cell surface receptors (By similarity). May be a putative tumor suppressor protein.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219122 | IGFBPL1 (Myc-DDK-tagged)-Human insulin-like growth factor binding protein-like 1 (IGFBPL1) |
CNY 2400.00 |
|
| RC219122L1 | Lenti ORF clone of Human insulin-like growth factor binding protein-like 1 (IGFBPL1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219122L2 | Lenti ORF clone of Human insulin-like growth factor binding protein-like 1 (IGFBPL1), mGFP tagged |
CNY 5890.00 |
|
| RC219122L3 | Lenti ORF clone of Human insulin-like growth factor binding protein-like 1 (IGFBPL1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219122L4 | Lenti ORF clone of Human insulin-like growth factor binding protein-like 1 (IGFBPL1), mGFP tagged |
CNY 5890.00 |
|
| RG219122 | IGFBPL1 (tGFP-tagged) - Human insulin-like growth factor binding protein-like 1 (IGFBPL1) |
CNY 4370.00 |
其它IGFBPL1产品
