TRIM72 (NM_001008274) Human Untagged Clone
CAT#: SC301279
TRIM72 (untagged)-Human tripartite motif containing 72 (TRIM72)
CNY 3656.00
CNY 7700.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MG53 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001008274, the custom clone sequence may differ by one or more nucleotides
ATGTCGGCTGCGCCCGGCCTCCTGCACCAGGAGCTGTCCTGCCCGCTGTGCCTGCAGCTGTTCGACGCGC CCGTGACAGCCGAGTGCGGCCACAGTTTCTGCCGCGCCTGCCTAGGCCGCGTGGCCGGGGAGCCGGCGGC GGATGGCACCGTTCTCTGCCCCTGCTGCCAGGCCCCCACGCGGCCGCAGGCACTCAGCACCAACCTGCAG CTGGCGCGCCTGGTGGAGGGGCTGGCCCAGGTGCCGCAGGGCCACTGCGAGGAGCACCTGGACCCGCTGA GCATCTACTGCGAGCAGGACCGCGCGCTGGTGTGCGGAGTGTGCGCCTCACTCGGCTCGCACCGCGGTCA TCGCCTCCTGCCTGCCGCCGAGGCCCACGCACGCCTCAAGACACAGCTGCCACAGCAGAAACTGCAGCTG CAGGAGGCATGCATGCGCAAGGAGAAGAGTGTGGCTGTGCTGGAGCATCAGCTGGTGGAGGTGGAGGAGA CAGTGCGTCAGTTCCGGGGGGCCGTGGGGGAGCAGCTGGGCAAGATGCGGGTGTTCCTGGCTGCACTGGA GGGCTCCTTGGACCGCGAGGCAGAGCGTGTACGGGGTGAGGCAGGGGTCGCCTTGCGCCGGGAGCTGGGG AGCCTGAACTCTTACCTGGAGCAGCTGCGGCAGATGGAGAAGGTCCTGGAGGAGGTGGCGGACAAGCCGC AGACTGAGTTCCTCATGAAATACTGCCTGGTGACCAGCAGGCTGCAGAAGATCCTGGCAGAGTCTCCCCC ACCCGCCCGTCTGGACATCCAGCTGCCAATTATCTCAGATGACTTCAAATTCCAGGTGTGGAGGAAGATG TTCCGGGCTCTGATGCCAGCGCTGGAGGAGCTGACCTTTGACCCGAGCTCTGCGCACCCGAGCCTGGTGG TGTCTTCCTCTGGCCGCCGCGTGGAGTGCTCGGAGCAGAAGGCGCCGCCGGCCGGGGAGGACCCGCGCCA GTTCGACAAGGCGGTGGCGGTGGTGGCGCACCAGCAGCTCTCCGAGGGCGAGCACTACTGGGAGGTGGAT GTTGGCGACAAGCCGCGCTGGGCGCTGGGCGTGATCGCGGCCGAGGCCCCCCGCCGCGGGCGCCTGCACG CGGTGCCCTCGCAGGGCCTGTGGCTGCTGGGGCTGCGCGAGGGCAAGATCCTGGAGGCACACGTGGAGGC CAAGGAGCCGCGCGCTCTGCGCAGCCCCGAGAGGCGGCCCACGCGCATTGGCCTTTACCTGAGCTTCGGC GACGGCGTCCTCTCCTTCTACGATGCCAGCGACGCCGACGCGCTCGTGCCGCTTTTTGCCTTCCACGAGC GCCTGCCCAGGCCCGTGTACCCCTTCTTCGACGTGTGCTGGCACGACAAGGGCAAGAATGCCCAGCCGCT GCTGCTCGTGGGTCCCGAAGGCGCCGAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001008274 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers these to be polymorphisms and to reflect the natural differences between individuals. These result in the substitution of 1 amino acids. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001008274.1, NP_001008275.1 |
RefSeq Size | 2098 bp |
RefSeq ORF | 1434 bp |
Locus ID | 493829 |
UniProt ID | Q6ZMU5 |
Gene Summary | Muscle-specific protein that plays a central role in cell membrane repair by nucleating the assembly of the repair machinery at injury sites. Specifically binds phosphatidylserine. Acts as a sensor of oxidation: upon membrane damage, entry of extracellular oxidative environment results in disulfide bond formation and homooligomerization at the injury site. This oligomerization acts as a nucleation site for recruitment of TRIM72-containing vesicles to the injury site, leading to membrane patch formation. Probably acts upstream of the Ca(2+)-dependent membrane resealing process. Required for transport of DYSF to sites of cell injury during repair patch formation. Regulates membrane budding and exocytosis. May be involved in the regulation of the mobility of KCNB1-containing endocytic vesicles (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218023 | TRIM72 (Myc-DDK-tagged)-Human tripartite motif containing 72 (TRIM72) |
CNY 3656.00 |
|
RC218023L1 | Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), Myc-DDK-tagged |
CNY 6056.00 |
|
RC218023L2 | Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), mGFP tagged |
CNY 5890.00 |
|
RC218023L3 | Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), Myc-DDK-tagged |
CNY 6056.00 |
|
RC218023L4 | Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), mGFP tagged |
CNY 6056.00 |
|
RG218023 | TRIM72 (tGFP-tagged) - Human tripartite motif containing 72 (TRIM72) |
CNY 5256.00 |