Legumain (LGMN) (NM_001008530) Human Untagged Clone
CAT#: SC301315
LGMN (untagged)-Human legumain (LGMN), transcript variant 2
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AEP; LGMN1; PRSC1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001008530, the custom clone sequence may differ by one or more nucleotides
ATGGTTTGGAAAGTAGCTGTATTCCTCAGTGTGGCCCTGGGCATTGGTGCCGTTCCTATAGATGATCCTG AAGATGGAGGCAAGCACTGGGTGGTGATCGTGGCAGGTTCAAATGGCTGGTATAATTATAGGCACCAGGC AGACGCGTGCCATGCCTACCAGATCATTCACCGCAATGGGATTCCTGACGAACAGATCGTTGTGATGATG TACGATGACATTGCTTACTCTGAAGACAATCCCACTCCAGGAATTGTGATCAACAGGCCCAATGGCACAG ATGTCTATCAGGGAGTCCCGAAGGACTACACTGGAGAGGATGTTACCCCACAAAATTTCCTTGCTGTGTT GAGAGGCGATGCAGAAGCAGTGAAGGGCATAGGATCCGGCAAAGTCCTGAAGAGTGGCCCCCAGGATCAC GTGTTCATTTACTTCACTGACCATGGATCTACTGGAATACTGGTTTTTCCCAATGAAGATCTTCATGTAA AGGACCTGAATGAGACCATCCATTACATGTACAAACACAAAATGTACCGAAAGATGGTGTTCTACATTGA AGCCTGTGAGTCTGGGTCCATGATGAACCACCTGCCGGATAACATCAATGTTTATGCAACTACTGCTGCC AACCCCAGAGAGTCGTCCTACGCCTGTTACTATGATGAGAAGAGGTCCACGTACCTGGGGGACTGGTACA GCGTCAACTGGATGGAAGATTCGGACGTGGAAGATCTGACTAAAGAGACCCTGCACAAGCAGTACCACCT GGTAAAATCGCACACCAACACCAGCCACGTCATGCAGTATGGAAACAAAACAATCTCCACCATGAAAGTG ATGCAGTTTCAGGGTATGAAACGCAAAGCCAGTTCTCCCGTCCCCCTACCTCCAGTCACACACCTTGACC TCACCCCCAGCCCTGATGTGCCTCTCACCATCATGAAAAGGAAACTGATGAACACCAATGATCTGGAGGA GTCCAGGCAGCTCACGGAGGAGATCCAGCGGCATCTGGATGCCAGGCACCTCATTGAGAAGTCAGTGCGT AAGATCGTCTCCTTGCTGGCAGCGTCCGAGGCTGAGGTGGAGCAGCTCCTGTCCGAGAGAGCCCCGCTCA CGGGGCACAGCTGCTACCCAGAGGCCCTGCTGCACTTCCGGACCCACTGCTTCAACTGGCACTCCCCCAC GTACGAGTATGCGTTGAGACATTTGTACGTGCTGGTCAACCTTTGTGAGAAGCCGTATCCGCTTCACAGG ATAAAATTGTCCATGGACCACGTGTGCCTTGGTCACTACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001008530 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008530.1, NP_001008530.1 |
RefSeq Size | 2166 bp |
RefSeq ORF | 1302 bp |
Locus ID | 5641 |
UniProt ID | Q99538 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Antigen processing and presentation, Lysosome |
Gene Summary | This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional exon in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200309 | LGMN (Myc-DDK-tagged)-Human legumain (LGMN), transcript variant 2 |
CNY 3,656.00 |
|
RC200309L3 | Lenti ORF clone of Human legumain (LGMN), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200309L4 | Lenti ORF clone of Human legumain (LGMN), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG200309 | LGMN (tGFP-tagged) - Human legumain (LGMN), transcript variant 2 |
CNY 4,370.00 |
|
SC320658 | LGMN (untagged)-Human legumain (LGMN), transcript variant 2 |
CNY 3,656.00 |