Gemin 2 (GEMIN2) (NM_001009183) Human Untagged Clone
CAT#: SC301395
GEMIN2 (untagged)-Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant gamma
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SIP1; SIP1-delta |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301395 representing NM_001009183.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGCCGAGCGGAACTGGCTGGTTTGAAAACCATGGCGTGGGTACCAGCGGAGTCCGCAGTGGAAGAG TTGATGCCTCGGCTATTGCCGGTAGAGCCTTGCGACTTGACGGAAGGTTTCGATCCCTCGGTACCCCCG AGGACGCCTCAGGAATACCTGAGGCGGGTCCAGATCGAAGCAGCTCAATGTCCAGATGTTGTGGTAGCT CAAATTGACCCAAAGAAGTTGAAAAGGAAGCAAAGTGTGAATATTTCTCTTTCAGGATGCCAACCCGCC CCTGAAGGTTATTCCCCAACACTTCAATGGCAACAGCAACAAGTGGCACAGTTTTCAACTGTTCGACAG AATGTGAACAAACATAGAAGTCACTGGAAATCACAACAGTTGGATAGTAATGTGACAATGCCAAAATCT GAAGATGAAGAAGGCTGGAAGAAATTTTGTCTGGGTGAAAAGTTATGTGCTGACGGGGCTGTTGGACCA GCCACAAATGAAAGTCCTGGAATAGATTATGTACAAATTGGTTTTCCTCCCTTGCTTAGTATTGTTAGC AGAATGAATCAGGCAACAGTAACTAGTGTCTTGGAATATCTGAGTAATTGGTTTGGAGAAAGAGACTTT ACTCCAGAATTGGGAAGATGGCTTTATGCTTTATTGGCTTGTCTTGAAAAGCCTTTGTTACCTGAGGCT CATTCACTGATTCGGCAGCTTGCAAGAAGGTGCTCTGAAGTGAGGCTCTTAGTGGTATTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001009183 |
| Insert Size | 753 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001009183.1 |
| RefSeq Size | 1309 bp |
| RefSeq ORF | 753 bp |
| Locus ID | 8487 |
| UniProt ID | O14893 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency |
| MW | 28.2 kDa |
| Gene Summary | This gene encodes one of the proteins found in the SMN complex, which consists of several gemin proteins and the protein known as the survival of motor neuron protein. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal snRNPs and for pre-mRNA splicing. This protein interacts directly with the survival of motor neuron protein and it is required for formation of the SMN complex. A knockout mouse targeting the mouse homolog of this gene exhibited disrupted snRNP assembly and motor neuron degeneration. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (gamma) lacks an internal exon, compared to variant alpha. It encodes isoform gamma which is shorter and has a unique C-terminus, compared to isoform alpha. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216807 | GEMIN2 (Myc-DDK-tagged)-Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant gamma |
CNY 2400.00 |
|
| RC216807L3 | Lenti ORF clone of Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant gamma, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC216807L4 | Lenti ORF clone of Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant gamma, mGFP tagged |
CNY 5890.00 |
|
| RG216807 | GEMIN2 (tGFP-tagged) - Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant gamma |
CNY 4370.00 |
其它Gemin 2产品
