HES5 (NM_001010926) Human Untagged Clone

CAT#: SC301536

HES5 (untagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5)



  "NM_001010926" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 3 publications.

Product images

推荐一起购买 (4)
HES5 mouse monoclonal antibody,clone OTI6F7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHb38
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001010926 edited
ATGGCCCCCAGCACTGTGGCCGTGGAGCTGCTCAGCCCCAAAGAGAAAAACCGACTGCGG
AAGCCGGTGGTGGAGAAGATGCGCCGCGACCGCATCAACAGCAGCATCGAGCAGCTGAAG
CTGCTGCTGGAGCAGGAGTTCGCGCGGCACCAGCCCAACTCCAAGCTGGAGAAGGCCGAC
ATCCTGGAGATGGCTGTCAGCTACCTGAAGCACAGCAAAGCCTTCGTCGCCGCCGCCGGC
CCCAAGAGCCTGCACCAGGACTACAGCGAAGGCTACTCGTGGTGCCTGCAGGAGGCCGTG
CAGTTCCTGACGCTCCACGCCGCCAGCGACACGCAGATGAAGCTGCTGTACCACTTCCAG
CGGCCCCCGGCCGCGCCCGCCGCGCCCGCCAAGGAGCCCAAGGCGCCGGGCGCCGCGCCC
CCGCCCGCGCTCTCCGCCAAGGCCACCGCCGCCGCCGCCGCCGCGCACCAGCCCGCCTGC
GGCCTCTGGCGGCCCTGGTGA
Restriction Sites Please inquire     
ACCN NM_001010926
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010926.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001010926.1, NP_001010926.1
RefSeq Size 1306 bp
RefSeq ORF 501 bp
Locus ID 388585
UniProt ID Q5TA89
Protein Families Druggable Genome, ES Cell Differentiation/IPS
Protein Pathways Notch signaling pathway
Gene Summary This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (3)

Other Versions

Customer Reviews 
Loading...