HES5 (NM_001010926) Human Untagged Clone
CAT#: SC301536
HES5 (untagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5)
CNY 2400.00
CNY 3990.00
Cited in 3 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb38 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001010926 edited
ATGGCCCCCAGCACTGTGGCCGTGGAGCTGCTCAGCCCCAAAGAGAAAAACCGACTGCGG AAGCCGGTGGTGGAGAAGATGCGCCGCGACCGCATCAACAGCAGCATCGAGCAGCTGAAG CTGCTGCTGGAGCAGGAGTTCGCGCGGCACCAGCCCAACTCCAAGCTGGAGAAGGCCGAC ATCCTGGAGATGGCTGTCAGCTACCTGAAGCACAGCAAAGCCTTCGTCGCCGCCGCCGGC CCCAAGAGCCTGCACCAGGACTACAGCGAAGGCTACTCGTGGTGCCTGCAGGAGGCCGTG CAGTTCCTGACGCTCCACGCCGCCAGCGACACGCAGATGAAGCTGCTGTACCACTTCCAG CGGCCCCCGGCCGCGCCCGCCGCGCCCGCCAAGGAGCCCAAGGCGCCGGGCGCCGCGCCC CCGCCCGCGCTCTCCGCCAAGGCCACCGCCGCCGCCGCCGCCGCGCACCAGCCCGCCTGC GGCCTCTGGCGGCCCTGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001010926 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010926.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001010926.1, NP_001010926.1 |
RefSeq Size | 1306 bp |
RefSeq ORF | 501 bp |
Locus ID | 388585 |
UniProt ID | Q5TA89 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
Protein Pathways | Notch signaling pathway |
Gene Summary | This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008] |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Transcription Factors with Conserved Binding Sites Near ATOH1 on the POU4F3 Gene Enhance the Induction of Cochlear Hair Cells
,Ikeda, R;Pak, K;Chavez, E;Ryan, AF;,
Mol. Neurobiol. July 2014
,PubMed ID 25015561
[HES5]
|
HES5 is as a key mediator of Wnt-3a induced neuronal differentiation
,Mußmann, C;Hübner, R;Trilck, M;Rolfs, A;Frech, MJ;,
Stem Cells Dev., Feb 2014.
,PubMed ID 24548083
[HES5]
|
Notch-1 stimulates survival of lung adenocarcinoma cells during hypoxia by activating the IGF-1R pathway
,S Eliasz, S Liang, Y Chen, M A De Marco, O Machek, S Skucha, L Miele, M Bocchetta,
Oncogene (15 February 2010) doi:10.1038/onc.2010.7 Original Article
[HES5]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215311 | HES5 (Myc-DDK-tagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5) |
CNY 1200.00 |
|
RC215311L1 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged |
CNY 3600.00 |
|
RC215311L2 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged |
CNY 5890.00 |
|
RC215311L3 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged |
CNY 5890.00 |
|
RC215311L4 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged |
CNY 3600.00 |
|
RG215311 | HES5 (tGFP-tagged) - Human hairy and enhancer of split 5 (Drosophila) (HES5) |
CNY 2800.00 |