Heterogeneous Nuclear Ribonucleoprotein (A1 like) (HNRNPA1L2) (NM_001011724) Human Untagged Clone

CAT#: SC301609

HNRNPA1L2 (untagged)-Human heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1



  "NM_001011724" in other vectors (6)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HNRNPA1L2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001011724 edited
CACCTTGCCGTCATGTCTAAGTCAGCGTCTCCAAAAGAGCCCGAACAGCTGAGGAAGCTC
TTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGCAA
TGGGGAACGCTCACAGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGGGC
TTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATACAACGCCA
CACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTCAA
AGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACACT
GAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTAATTGAAATC
ATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACCAT
GACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAAGGGCCACAACTGTGAA
GTTAGAAAAGCCCTGCCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGA
AGGGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGATGGTTTCGGTGGGAATGACAACTTT
GGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCTGTGGTGGTGGTGGA
TATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGAAGCAATTTTGGAGGT
GGTGGAAGCTACAATGATTTTGGCAATTACAACAATCAGTCTTCAAATTTTGGACCCATG
AAGGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCTATGGCGGTGGAGGCCAATACTTT
GCAAAACCACAAAACCAAGGTGGCTATGGCGTTTCCAGCAGCAGCAGTAGCTATGGCAGT
GGCAGAAGATTTTAA
Restriction Sites Please inquire     
ACCN NM_001011724
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001011724.1, NP_001011724.1
RefSeq Size 2365 bp
RefSeq ORF 963 bp
Locus ID 144983
UniProt ID Q32P51
Protein Pathways Spliceosome
Gene Summary Involved in the packaging of pre-mRNA into hnRNP particles, transport of poly(A) mRNA from the nucleus to the cytoplasm and may modulate splice site selection.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Heterogeneous Nuclear Ribonucleoprotein (A1 like)产品

Customer Reviews 
Loading...