FTS (AKTIP) (NM_001012398) Human Untagged Clone

CAT#: SC301640

AKTIP (untagged)-Human AKT interacting protein (AKTIP), transcript variant 1



  "NM_001012398" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
AKTIP Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FT1; FTS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301640 representing NM_001012398.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACCCTTTCTGGAGCATGTCTACAAGCTCTGTACGCAAACGATCTGAAGGTGAAGAGAAGACATTA
ACAGGGGACGTGAAAACCAGTCCTCCACGAACTGCACCAAAGAAACAGCTGCCTTCTATTCCCAAAAAT
GCTTTGCCCATAACTAAGCCTACATCTCCTGCCCCAGCAGCACAGTCAACAAATGGCACGCATGCGTCC
TATGGACCCTTCTACCTGGAATACTCTCTTCTTGCAGAATTTACCTTGGTTGTGAAGCAGAAGCTACCA
GGCGTCTATGTGCAGCCATCTTATCGCTCTGCATTAATGTGGTTTGGAGTAATATTCATACGGCATGGA
CTTTACCAAGATGGCGTATTTAAGTTTACAGTTTACATCCCTGATAACTATCCAGATGGTGACTGTCCA
CGCTTGGTGTTCGATATTCCTGTCTTTCACCCGCTAGTTGATCCCACCTCAGGTGAGCTGGATGTGAAG
AGAGCATTTGCAAAATGGAGGCGGAACCATAATCATATTTGGCAGGTATTAATGTATGCAAGGAGAGTT
TTCTACAAGATTGATACAGCAAGCCCCCTGAACCCAGAGGCTGCAGTACTGTATGAAAAAGATATTCAG
CTTTTTAAAAGTAAAGTTGTTGACAGTGTTAAGGTGTGCACTGCTCGTTTGTTTGACCAACCTAAAATA
GAAGACCCCTATGCAATTAGCTTTTCTCCATGGAATCCTTCTGTACATGATGAAGCCAGAGAAAAGATG
CTGACTCAGAAAAAGCCTGAAGAACAGCACAATAAAAGTGTTCATGTTGCTGGCCTGTCATGGGTAAAG
CCTGGCTCAGTACAGCCTTTCAGTAAAGAAGAGAAAACAGTGGCGACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001012398
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012398.2
RefSeq Size 2525 bp
RefSeq ORF 879 bp
Locus ID 64400
UniProt ID Q9H8T0
MW 33.1 kDa
Gene Summary The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...