IL32 (NM_001012633) Human Untagged Clone

CAT#: SC301682

IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 4



  "NM_001012633" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal IL-32 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001012633 edited
ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGCACCAG
GCCATAGAAAGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGATG
TCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCT
TATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTATTTGAAAAAGAAAGAGATGGATTA
CGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCT
GGGGAGAGCTTTTGTGACAAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACA
CCCCAGAAGTGCTCTGAACCCCAATCCTCAAAATGA
>OriGene 5' read for NM_001012633 unedited
CACGAGGGGTGACTGTCTCAGTGGAGCTGGGTCATCTCAGGCCTTGGCTCCTTGAACTTT
TGGCCGCCATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAA
TGCACCAGGCCATAGAAAGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGAC
AGGTGATGTCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAG
TGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTATTTGAAAAAGAAAGAG
ATGGATTACGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCG
AGGAGCCTGGGGAGAGCTTTTGTGACAAGTCCTACGGAGCCCCACGGGGGGACAAGGAGG
AGCTGACACCCCAGAAGTGCTCTGAACCCCAATCCTCAAAATGAAGATACTGACACCACC
TTTGCCCTCCCCGTCACCGCGCACCCACCCTGACCCCTCCCTCAGCTGTCCTGTGCCCCG
CCCTCTCCCGCACACTCAGTCCCCCTGCCTGGCGTTCCTGCCGCAGCTCTGACCTGGTGC
TGTCGCCCTGGCATCTTAATAAAACCTGCTTATACTTCCCTGGC
Restriction Sites Please inquire     
ACCN NM_001012633
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals. This results in the substitution of 1 amino acid.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012633.1, NP_001012651.1
RefSeq Size 919 bp
RefSeq ORF 396 bp
Locus ID 9235
UniProt ID P24001
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks an alternate exon in the 5' UTR and contains an alternate intron within the last exon of the coding region, compared to variant 1. The encoded isoform (A), also referred to as IL-32alpha, is shorter compared to isoform B. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...