TCEAL5 (NM_001012979) Human Untagged Clone
CAT＃: SC301747
TCEAL5 (untagged)-Human transcription elongation factor A (SII)-like 5 (TCEAL5)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | WEX4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301747 representing NM_001012979.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAAAGCTCTACAAAGAAAATGAAGGAAAGCCAGAGAATGAAAGAAACCTAGAAAGTGAGGGAAAG CCAGAGGATGAGGGAAGTACAGAAGATGAAGGAAAGTCAGACGAGGAAGAAAAGCCGGACATGGAGGGG AAGACAGAATGCGAGGGAAAGCGAGAGGATGAGGGAGAGCCAGGTGATGAGGGACAACTGGAAGATGAG GGAAACCAGGAAAAGCAGGGCAAGTCTGAAGGTGAGGACAAGCCACAAAGTGAGGGCAAGCCAGCCTCC CAGGCCAAGCCAGAGAGCCAGCCGCGGGCCGCCGAAAAGCGCCCGGCTGAAGATTATGTGCCCCGGAAA GCAAAAAGAAAAACCGACAGGGGGACGGACGATTCCCCCAAGGACTCTCAGGAGGACTTACAAGAAAGG CATCTGAGCAGTGAGGAGATGATGAGAGAATGTGGAGATGTGTCAAGGGCTCAGGAGGAGCTAAGGAAA AAACAGAAAATGGGTGGTTTTCATTGGATGCAAAGAGATGTACAGGATCCATTCGCCCCAAGGGGCCAA CGGGGTGTGAGGGGAGTGAGGGGCGGAGGTAGGGGCCAGAAAGACTTAGAAGATGTCCCATATGTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001012979 |
| Insert Size | 621 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001012979.2 |
| RefSeq Size | 1166 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 340543 |
| UniProt ID | Q5H9L2 |
| MW | 23.3 kDa |
| Gene Summary | This gene, which is located on the X chromosome, encodes a protein which contains a BEX (brain expressed X-liked like family) domain. This domain is found in proteins encoded by the TCEAL elongation factor (transcription elongation factor A (SII)-like) gene family also located on the X chromosome. The coding region for this gene is located entirely in the terminal exon. [provided by RefSeq, Sep 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217441 | TCEAL5 (Myc-DDK-tagged)-Human transcription elongation factor A (SII)-like 5 (TCEAL5) |
CNY 2400.00 |
|
| RC217441L3 | Lenti ORF clone of Human transcription elongation factor A (SII)-like 5 (TCEAL5), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC217441L4 | Lenti ORF clone of Human transcription elongation factor A (SII)-like 5 (TCEAL5), mGFP tagged |
CNY 5890.00 |
|
| RG217441 | TCEAL5 (tGFP-tagged) - Human transcription elongation factor A (SII)-like 5 (TCEAL5) |
CNY 4000.00 |
