SULT1A4 (NM_001017390) Human Untagged Clone
CAT#: SC302030
SULT1A4 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HAST3; M-PST; ST1A3; ST1A3/ST1A4; ST1A4; STM; TL-PST |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_177552, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGATCCAGGACACCTCCCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACT TTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAAGCCCGACCTGATGACCTGCTCATCAACACCTACCC CAAGTCTGGCACCACCTGGGTGAGCCAGATACTGGACATGATCTACCAGGGCGGCGACCTAGAGAAGTGT AACCGGGCTCCCATCTACGTACGGGTGCCCTTCCTTGAGGTCAATGATCCAGGGGAACCCTCAGGGCTGG AGACTCTGAAAGACACACCGCCCCCACGGCTCATCAAGTCACACCTGCCCCTGGCTCTGCTCCCTCAGAC TCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGAAACCCAAAGGACGTGGCGGTCTCCTACTAC CATTTCCACCGTATGGAAAAGGCGCACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAAAAGTTCATGG CTGGAGAAGTGTCCTACGGGTCCTGGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCC TGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCCAAAAGGGAGATTCAAAAGATCCTGGAGTTT GTGGGGCGCTCCCTGCCAGAGGAGACCATGGACTTCATGGTTCAGCACACGTCGTTCAAGGAGATGAAGA AGAACCCTATGACCAACTACACCACCGTCCCCCAGGAGCTCATGGACCACAGCATCTCCCCCTTCATGAG GAAAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTAT GCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001017390 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001017390.1, NP_001017390.1 |
| RefSeq Size | 1391 bp |
| RefSeq ORF | 888 bp |
| Locus ID | 445329 |
| UniProt ID | P50224 |
| Protein Pathways | Sulfur metabolism |
| Gene Summary | Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209931 | SULT1A4 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4) |
CNY 2400.00 |
|
| RC209931L1 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC209931L2 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), mGFP tagged |
CNY 5890.00 |
|
| RC209931L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC209931L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), mGFP tagged |
CNY 5890.00 |
|
| RG209931 | SULT1A4 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4) |
CNY 4370.00 |
其它SULT1A4产品
