TSH Receptor (TSHR) (NM_001018036) Human Untagged Clone

CAT#: SC302133

TSHR (untagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 2



  "NM_001018036" in other vectors (4)

CNY 2,640.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-TSHR Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHNG1; hTSHR-I; LGR3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001018036, the custom clone sequence may differ by one or more nucleotides
ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGC
GGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACC
TGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATT
GAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGA
ATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTG
AGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGAT
GCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATG
TTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGAC
AACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTG
ACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACA
AAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCA
TTTGGAGGAGTATACAGTGGACCAAGCTTGCTGCTACCTCTTGGAAGAAAGTCCTTGTCC
TTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA
Restriction Sites Please inquire     
ACCN NM_001018036
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018036.1, NP_001018046.1
RefSeq Size 1183 bp
RefSeq ORF 762 bp
Locus ID 7253
UniProt ID P16473
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Autoimmune thyroid disease, Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (2), also called ST4, differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...