ZNF197 (NM_001024855) Human Untagged Clone
CAT#: SC302307
ZNF197 (untagged)-Human zinc finger protein 197 (ZNF197), transcript variant 2
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D3S1363E; P18; VHLaK; ZKSCAN9; ZNF20; ZNF166; ZSCAN41 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302307 representing NM_001024855.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAAGAGAAAATGTAGCCCACAATGCTCTGAGACAAGAGGGCCTTGTGAAGGGGAAGGATGATACC TGGAAATGGGGAACCAGCTTCCAAGGAAGTAGCTCCTCTGTTTGGGAGACCTCCCACCTACACTTTAGA CAATTACGTTACCATGAGACATCTGGACCCCAGGAAGCCCTGAGCCGGCTCAGGGAACTCTGTCGCCGG TGGCTGAGACCAGAAGCACGCACCAAGGCACAGATCCTGGAGCTGCTGGTGCTGGAGCAGTTTCTGAGC ATCCTGCCTGGGGAGATTCGGACCTGGGTACAGCTCCATCACCCTGGAAGTGGCGAGGAGGCTGTGGCC CTGGTAGAGGAGCTGCAGAAAGACCTTGATGGACCAGCAATACAAGTTCCAGTCCTTGTCAAGGATCAG GACACTCTCCAGAAGGTGGTGAGTGCCCCAGGAACAACACTTCCTCCTGTACTTCCTGGCAGCCACATA GCAGCTGAAATTTGCCCGCATCCTCCTACTGACCTAGTGGCATTCAACCTCCAGGATCCTCAGCATGAT TCTCCTGCCCCTGAAGCTTCTGCCCTTTCCCAGGAAGAGAACCCAAGAAATCAATTAATGGCACTTATG CTCCTAACAGCCCAGCCCCAGGAGTTGGTGATGTTCGAGGAGGTGTCAGTATGCTTCACTTCAGAGGAA TGGGCATGTCTGGGCCCAATCCAGAGGGCCTTGTACTGGGATGTGATGCTGGAGAATTATGGAAATGTG ACCTCCCTAGGTTACAGGAAATACAGGAGGCAGAGGAACAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024855 |
Insert Size | 804 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024855.2 |
RefSeq Size | 2969 bp |
RefSeq ORF | 804 bp |
Locus ID | 10168 |
UniProt ID | O14709 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 30.2 kDa |
Gene Summary | This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein contains 20 tandemly arrayed C2H2-type zinc fingers, a Kruppel-associated box (KRAB) domain, and a SCAN box. This transcript turns over rapidly and contains 3' UTR AUUUA motifs, which are often a hallmark of rapid turnover. It is overexpressed in some thyroid papillary carcinomas. This gene is located in a cluster of zinc finger genes at 3p21. Naturally-occurring readthrough transcription is observed between this gene and the upstream zinc finger protein 660 gene and is represented by GeneID:110354863. [provided by RefSeq, May 2017] Transcript Variant: Variants 2 and 4 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216051 | ZNF197 (Myc-DDK-tagged)-Human zinc finger protein 197 (ZNF197), transcript variant 2 |
CNY 2400.00 |
|
RC216051L3 | Lenti ORF clone of Human zinc finger protein 197 (ZNF197), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216051L4 | Lenti ORF clone of Human zinc finger protein 197 (ZNF197), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG216051 | ZNF197 (tGFP-tagged) - Human zinc finger protein 197 (ZNF197), transcript variant 2 |
CNY 4370.00 |