CLLU1 (NM_001025233) Human Untagged Clone
CAT＃: SC302372
CLLU1 (untagged)-Human chronic lymphocytic leukemia up-regulated 1 (CLLU1)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302372 representing NM_001025233.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCAACAAATGCTCCTTTCATTCCTCTATTTACAGACCTGCCGCAGACAATTCTGCTAGCAGCCTT TGTGCTATTATCTGTTTTCTAAACTTAGTAATTGAGTGTGATCTGGAGACTAACTCTGAAATAAATAAG CTGATTATTTATTTATTTTCTCAAAACAACAGAATACGATTTAGCAAATTACTTCTTAAGATATTATTT TACATTTCTATATTCTCCTACCCTGAGTTGATGTGTGAGCAATATGTCACTTTCATAAAGCCAGGTATA CATTATGGACAGGTAAGTAAAAAACATATTATTTATTCTACGTTTTTGTCCAAAAATTTTAAATTTCAA CTGTTGCGCGTGTGTTGGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001025233 |
| Insert Size | 366 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025233.2 |
| RefSeq Size | 3945 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 574028 |
| MW | 14.2 kDa |
| Gene Summary | Expression of this gene has been shown to be upregulated in some individuals with chronic lymphocytic leukemia (CLL), and has been used for prognostic and diagnostic purposes. This gene was originally identified as a human-specific putative protein-coding gene due to the presence of a peptide (PAp00140670, HIIYSTFLSK) that could have supported translation at this locus. This peptide is not present in more recent builds of PeptideAtlas, and the presence of a protein product at this locus has not been independently verified. For this reason, this gene is being represented as non-coding. Sequence comparisons to other primates indicates that no other primate is predicted to contain an open reading frame. [provided by RefSeq, Feb 2017] Transcript Variant: This variant (1) represents the longest transcript and is protein-coding. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220420 | CLLU1 (Myc-DDK-tagged)-Human chronic lymphocytic leukemia up-regulated 1 (CLLU1) |
CNY 1200.00 |
|
| RC220420L3 | Lenti ORF clone of Human chronic lymphocytic leukemia up-regulated 1 (CLLU1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220420L4 | Lenti ORF clone of Human chronic lymphocytic leukemia up-regulated 1 (CLLU1), mGFP tagged |
CNY 5890.00 |
|
| RG220420 | CLLU1 (tGFP-tagged) - Human chronic lymphocytic leukemia up-regulated 1 (CLLU1) |
CNY 4370.00 |
