IFITM5 (NM_001025295) Human Untagged Clone
CAT#: SC302389
IFITM5 (untagged)-Human interferon induced transmembrane protein 5 (IFITM5)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRIL; DSPA1; fragilis4; Hrmp1; OI5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001025295 edited
GTTACCAGTCTGAGTGTGGAAGAGACGGCGCTGGAACCCATGGACACGGCGTATCCCCGC GAGGACACCCGGGCCCCCACGCCCAGCAAGGCCGGTGCCCACACAGCCCTCACACTGGGG GCCCCGCACCCCCCGCCTCGAGACCACTTGATCTGGTCGGTGTTCAGCACCCTCTACCTG AATCTGTGTTGCCTCGGCTTCCTGGCGCTGGCCTACTCCATCAAGGCCCGAGATCAGAAG GTGGTTGGTGACCTGGAAGCGGCCCGGCGTTTTGGCTCCAAAGCCAAGTGCTACAACATC CTGGCCGCGATGTGGACGCTGGTGCCGCCACTGCTGCTCCTGGGGCTGGTGGTGACTGGT GCCCTGCACCTGGCCCGGCTGGCCAAGGACTCTGCCGCCTTCTTCAGCACCAAGTTTGAT GACGCGGACTATGACTGACAGGCTGGGTCCTGATCTGGGGCACTAGCCCCAGGACACTGA CCCCAGGCTGCTGCCCCTGGGGCCCAATACTGACTCCCCGGAGCCTGGCCCTCCTTCTGT GGGGCCTCCATCCCTGCCCCATCCTGATCCTGGGGCCCTCCAGCCCCAACATGGGCACCT AAAGCTGAACCAGTCAGACCCCGGGGTCTTCACCCTAACCCGAGAGTTCCCGGGCCCTAA CTCTGCCCCCGATCCTGCCCCTCCCTCCTCACACTCCAGGCCCCTCGGTTCCACGATTAA AAGTGCCTGGTTCCAG |
Restriction Sites | Please inquire |
ACCN | NM_001025295 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001025295.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025295.1, NP_001020466.1 |
RefSeq Size | 733 bp |
RefSeq ORF | 399 bp |
Locus ID | 387733 |
UniProt ID | A6NNB3 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213834 | IFITM5 (Myc-DDK-tagged)-Human interferon induced transmembrane protein 5 (IFITM5) |
CNY 1200.00 |
|
RC213834L1 | Lenti ORF clone of Human interferon induced transmembrane protein 5 (IFITM5), Myc-DDK-tagged |
CNY 3600.00 |
|
RC213834L2 | Lenti ORF clone of Human interferon induced transmembrane protein 5 (IFITM5), mGFP tagged |
CNY 5890.00 |
|
RC213834L3 | Lenti ORF clone of Human interferon induced transmembrane protein 5 (IFITM5), Myc-DDK-tagged |
CNY 5890.00 |
|
RC213834L4 | Lenti ORF clone of Human interferon induced transmembrane protein 5 (IFITM5), mGFP tagged |
CNY 3600.00 |
|
RG213834 | IFITM5 (tGFP-tagged) - Human interferon induced transmembrane protein 5 (IFITM5) |
CNY 2800.00 |