IFITM5 (NM_001025295) Human Untagged Clone

CAT#: SC302389

IFITM5 (untagged)-Human interferon induced transmembrane protein 5 (IFITM5)



  "NM_001025295" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-IFITM5 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRIL; DSPA1; fragilis4; Hrmp1; OI5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001025295 edited
GTTACCAGTCTGAGTGTGGAAGAGACGGCGCTGGAACCCATGGACACGGCGTATCCCCGC
GAGGACACCCGGGCCCCCACGCCCAGCAAGGCCGGTGCCCACACAGCCCTCACACTGGGG
GCCCCGCACCCCCCGCCTCGAGACCACTTGATCTGGTCGGTGTTCAGCACCCTCTACCTG
AATCTGTGTTGCCTCGGCTTCCTGGCGCTGGCCTACTCCATCAAGGCCCGAGATCAGAAG
GTGGTTGGTGACCTGGAAGCGGCCCGGCGTTTTGGCTCCAAAGCCAAGTGCTACAACATC
CTGGCCGCGATGTGGACGCTGGTGCCGCCACTGCTGCTCCTGGGGCTGGTGGTGACTGGT
GCCCTGCACCTGGCCCGGCTGGCCAAGGACTCTGCCGCCTTCTTCAGCACCAAGTTTGAT
GACGCGGACTATGACTGACAGGCTGGGTCCTGATCTGGGGCACTAGCCCCAGGACACTGA
CCCCAGGCTGCTGCCCCTGGGGCCCAATACTGACTCCCCGGAGCCTGGCCCTCCTTCTGT
GGGGCCTCCATCCCTGCCCCATCCTGATCCTGGGGCCCTCCAGCCCCAACATGGGCACCT
AAAGCTGAACCAGTCAGACCCCGGGGTCTTCACCCTAACCCGAGAGTTCCCGGGCCCTAA
CTCTGCCCCCGATCCTGCCCCTCCCTCCTCACACTCCAGGCCCCTCGGTTCCACGATTAA
AAGTGCCTGGTTCCAG
Restriction Sites Please inquire     
ACCN NM_001025295
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001025295.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025295.1, NP_001020466.1
RefSeq Size 733 bp
RefSeq ORF 399 bp
Locus ID 387733
UniProt ID A6NNB3
Protein Families Transmembrane
Gene Summary This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...