VEGFA (NM_001025368) Human Untagged Clone

CAT#: SC302396

VEGFA (untagged)-Human vascular endothelial growth factor A (VEGFA), transcript variant 4



  "NM_001025368" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
VEGFA (VEGF) mouse monoclonal antibody, clone OTI4E3 (formerly 4E3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MVCD1; VEGF; VPF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC302396 sequence for NM_001025368 edited (data generated by NextGen Sequencing)


CTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCTACCACCTCCTCCCCGGCCGGCGGCGGACAG
TGGACGCGGCGGCGAGCCGCGGGCAGGGGCCGGAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGGGC
TCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCTGTTCTCGCTTCGGAGGAGCCGTGGTCCGC
GCGGGGGAAGCCGAGCCGAGCGGAGCCGCGAGAAGTGCTAGCTCGGGCCGGGAGGAGCCGCAGCCGGAGG
AGGGGGAGGAGGAAGAAGAGAAGGAAGAGGAGAGGGGGCCGCAGTGGCGACTCGGCGCTCGGAAGCCGGG
CTCATGGACGGGTGAGGCGGCGGTGTGCGCAGACAGTGCTCCAGCCGCGCGCGCTCCCCAGGCCCTGGCC
CGGGCCTCGGGCCGGGGAGGAAGAGTAGCTCGCCGAGGCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGA
GCCGGAGAGGGAGCGCGAGCCGCGCCGGCCCCGGTCGGGCCTCCGAAACCATGAACTTTCTGCTGTCTTG
GGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCA
GAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATC
CAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTG
TGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCC
AACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTAC
AGCACAACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAATCCCTGTGGGCCTTGCTC
AGAGCGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCG
CGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCGAGGCGGTGA


Clone variation with respect to NM_001025368.2
Restriction Sites Please inquire     
ACCN NM_001025368
Insert Size 2000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to perfectly match with NM_001025368.1. This clone uses an alternative start codon CTG.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025368.1, NP_001020539.2
RefSeq Size 3554 bp
RefSeq ORF 1116 bp
Locus ID 7422
UniProt ID P15692
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Bladder cancer, Cytokine-cytokine receptor interaction, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma, VEGF signaling pathway
Gene Summary This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. The levels of VEGF are increased during infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), thus promoting inflammation by facilitating recruitment of inflammatory cells, and by increasing the level of angiopoietin II (Ang II), one of two products of the SARS-CoV-2 binding target, angiotensin-converting enzyme 2 (ACE2). In turn, Ang II facilitates the elevation of VEGF, thus forming a vicious cycle in the release of inflammatory cytokines. [provided by RefSeq, Jun 2020]
Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. This variant can initiate translation from four non-AUG (CUG) sites, and also from a downstream, in-frame AUG. The isoform (d) represented in this RefSeq is derived from the 5'-most CUG start codon, and is shorter than isoform a. CCDS Note: This CCDS representation starts at an upstream non-AUG (CUG) translation start codon that is supported by conservation data and experimental evidence, including that in PMIDs:11352659, 11563986 and 11731620. This transcript variant is supported by the full-length mRNA BC058855.1. Alternative translation initiation from a downstream AUG codon (Met-181), which results in a shorter isoform with a predicted signal peptide, has also been shown for this gene. The shorter isoform encoded by this variant is represented by CCDS 55012.1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...