NQO1 (NM_001025433) Human Untagged Clone
CAT#: SC302402
NQO1 (untagged)-Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DHQU; DIA4; DTD; NMOR1; NMORI; QR1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001025433 edited
CAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGGGTCGCCCC GGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGCAGAA GAGCACTGATCGTACTGGCTCACTCAGAGAGGACGTCCTTCAACTATGCCATGAAGGAGG CTGCTGCAGCGGCTTTGAAGAAGAAAGGATGGGAGGTGGTGGAGTCGGACCTCTATGCCA TGAACTTCAATCCCATCATTTCCAGAAAGGACATCACAGGTAAACTGAAGGACCCTGCGA ACTTTCAGTATCCTGCCGAGTCTGTTCTGGCTTATAAAGAAGGCCATCTGAGCCCAGATA TTGTGGCTGAACAAAAGAAGCTGGAAGCCGCAGACCTTGTGATATTCCAGTTCCCCCTGC AGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGT TTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTGGCATTCTGCATT TCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAG ACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGA CACCACTGTATTTTGCTCCAAGCAGCCTCTTTGACCTAAACTTCCAGGCAGGATTCTTAA TGAAAAAAGAGGTACAGGATGAGGAGAAAAACAAGAAATTTGGCCTTTCTGTGGGCCATC ACTTGGGCAAGTCCATCCCAACTGACAACCAGATCAAAGCTAGAAAATGAGATTCCTTAG CCTGGATTTCCTTCTAACATGTTATCAAATCTGGGTATCTTTCCAGGCTTCCCTGACTTG CTTTAGTTTTTAAGATTTGTGTTTTTCTTTTTCCACAAGGAATAAATGAGAGGGAATCGA CAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_001025433 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001025433.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025433.1, NP_001020604.1 |
| RefSeq Size | 2499 bp |
| RefSeq ORF | 723 bp |
| Locus ID | 1728 |
| UniProt ID | P15559 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1. The resulting protein (isoform b) is shorter than isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223447 | NQO1 (Myc-DDK-tagged)-Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 2 |
CNY 2640.00 |
|
| RC223447L3 | Lenti-ORF clone of NQO1 (Myc-DDK-tagged)-Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 2 |
CNY 5890.00 |
|
| RC223447L4 | Lenti-ORF clone of NQO1 (mGFP-tagged)-Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 2 |
CNY 5890.00 |
|
| RG223447 | NQO1 (tGFP-tagged) - Human NAD(P)H dehydrogenase, quinone 1 (NQO1), transcript variant 2 |
CNY 4240.00 |
