Ribosomal Protein S29 (RPS29) (NM_001030001) Human Untagged Clone
CAT#: SC302483
RPS29 (untagged)-Human ribosomal protein S29 (RPS29), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DBA13; S29; uS14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302483 representing NM_001030001.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTCGTGTC TGTTCAAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGTAC GCGAAGGATATCGGTTTCATTAAGAAAGACCTGAGCTGTCTTCCTTGGCACTGCCTATGGAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001030001 |
Insert Size | 204 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001030001.2 |
RefSeq Size | 1414 bp |
RefSeq ORF | 204 bp |
Locus ID | 6235 |
UniProt ID | P62273 |
Protein Pathways | Ribosome |
MW | 8.1 kDa |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2) utilizes an alternate 3'-terminal exon, compared to variant 1, resulting in a longer isoform (2) with a unique C-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216475 | RPS29 (Myc-DDK-tagged)-Human ribosomal protein S29 (RPS29), transcript variant 2 |
CNY 1200.00 |
|
RC216475L3 | Lenti ORF clone of Human ribosomal protein S29 (RPS29), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216475L4 | Lenti ORF clone of Human ribosomal protein S29 (RPS29), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG216475 | RPS29 (tGFP-tagged) - Human ribosomal protein S29 (RPS29), transcript variant 2 |
CNY 2800.00 |
其它Ribosomal Protein S29产品