DNAJB14 (NM_001031723) Human Untagged Clone

CAT#: SC302568

DNAJB14 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 14 (DNAJB14), transcript variant 1



  "NM_001031723" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-DNAJB14 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EGNR9427; PRO34683
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302568 representing NM_001031723.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGGGAACAGGGATGAGGCTGAGAAATGTGTCGAGATCGCCCGGGAGGCCCTGAACGCCGGCAAC
CGCGAGAAGGCCCAGCGCTTCCTGCAGAAGGCCGAGAAGCTCTACCCACTGCCCTCGGCCCGCGCACTA
TTGGAAATAATTATGAAAAATGGAAGCACGGCTGGAAATAGCCCTCATTGCCGAAAACCATCAGGTAGT
GGCGATCAAAGCAAGCCTAATTGCACAAAGGACAGCACATCTGGTAGTGGTGAAGGTGGAAAAGGCTAT
ACCAAAGACCAAGTAGATGGAGTTCTCAGCATAAACAAATGTAAAAATTACTATGAAGTACTTGGAGTT
ACGAAAGATGCTGGTGATGAAGATTTGAAAAAAGCTTATAGAAAGCTTGCTTTGAAGTTTCATCCAGAC
AAAAACCATGCACCTGGAGCAACAGATGCTTTTAAAAAGATTGGAAATGCTTATGCTGTTTTAAGTAAT
CCAGAAAAGCGAAAACAGTATGACCTCACGGGCAATGAAGAACAAGCATGTAACCACCAAAACAATGGC
AGATTTAATTTCCATAGAGGTTGTGAAGCTGATATAACTCCAGAAGACTTGTTTAATATATTTTTTGGG
GGTGGATTTCCTTCAGGTAGTGTACATTCTTTTTCAAATGGAAGAGCTGGTTATAGCCAACAACATCAG
CATCGACATAGTGGACATGAAAGAGAAGAGGAAAGAGGAGATGGAGGTTTTTCTGTGTTTATCCAGCTG
ATGCCCATAATTGTATTGATCCTCGTGTCATTATTAAGCCAGTTGATGGTCTCTAATCCTCCTTATTCC
TTATATCCCAGATCTGGAACTGGGCAAACTATTAAAATGCAAACAGAAAACTTGGGTGTTGTTTATTAT
GTCAACAAGGACTTCAAAAATGAATATAAAGGAATGTTATTACAAAAGGTAGAAAAGAGTGTGGAGGAA
GATTATGTGACTAATATTCGAAATAACTGCTGGAAAGAAAGACAACAAAAAACAGATATGCAGTATGCA
GCAAAAGTATACCGTGATGATCGACTCCGAAGGAAGGCAGATGCCTTGAGCATGGACAACTGTAAAGAA
TTAGAGCGGCTTACCAGTCTTTATAAAGGAGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001031723
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001031723.3
RefSeq Size 6088 bp
RefSeq ORF 1140 bp
Locus ID 79982
UniProt ID Q8TBM8
MW 42.5 kDa
Gene Summary Acts as a co-chaperone with HSPA8/Hsc70; required to promote protein folding and trafficking, prevent aggregation of client proteins, and promote unfolded proteins to endoplasmic reticulum-associated degradation (ERAD) pathway (PubMed:24732912). Acts by determining HSPA8/Hsc70's ATPase and polypeptide-binding activities (PubMed:24732912). Can also act independently of HSPA8/Hsc70: together with DNAJB12, acts as a chaperone that promotes maturation of potassium channels KCND2 and KCNH2 by stabilizing nascent channel subunits and assembling them into tetramers (PubMed:27916661). While stabilization of nascent channel proteins is dependent on HSPA8/Hsc70, the process of oligomerization of channel subunits is independent of HSPA8/Hsc70 (PubMed:27916661). When overexpressed, forms membranous structures together with DNAJB12 and HSPA8/Hsc70 within the nucleus; the role of these structures, named DJANGOs, is still unclear (PubMed:24732912).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...