SAR1B (NM_001033503) Human Untagged Clone
CAT#: SC302705
SAR1B (untagged)-Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ANDD; CMRD; GTBPB; SARA2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302705 representing NM_001033503.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCTTCATATTTGATTGGATTTACAGTGGTTTCAGCAGTGTGCTACAGTTTTTAGGATTATATAAG AAAACTGGTAAACTGGTATTTCTTGGATTGGATAATGCAGGAAAAACAACATTGCTACACATGCTAAAA GATGACAGACTTGGACAACATGTCCCAACATTACATCCCACTTCCGAAGAACTGACCATTGCTGGCATG ACGTTTACAACTTTTGATCTGGGTGGACATGTTCAAGCTCGAAGAGTGTGGAAAAACTACCTTCCTGCT ATCAATGGCATTGTATTTCTGGTGGATTGTGCAGACCACGAAAGGCTGTTAGAGTCAAAAGAAGAACTT GATTCACTAATGACAGATGAAACCATTGCTAATGTGCCTATACTGATTCTTGGGAATAAGATCGACAGA CCTGAAGCCATCAGTGAAGAGAGGTTGCGAGAGATGTTTGGTTTATATGGTCAGACAACAGGAAAGGGG AGTATATCTCTGAAAGAACTGAATGCCCGACCCTTAGAAGTTTTCATGTGTAGTGTGCTCAAAAGACAA GGTTACGGAGAAGGCTTCCGCTGGATGGCACAGTACATTGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033503 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033503.2 |
RefSeq Size | 6651 bp |
RefSeq ORF | 597 bp |
Locus ID | 51128 |
UniProt ID | Q9Y6B6 |
MW | 22.4 kDa |
Gene Summary | The protein encoded by this gene is a small GTPase that acts as a homodimer. The encoded protein is activated by the guanine nucleotide exchange factor PREB and is involved in protein transport from the endoplasmic reticulum to the Golgi. This protein is part of the COPII coat complex. Defects in this gene are a cause of chylomicron retention disease (CMRD), also known as Anderson disease (ANDD). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213692 | SAR1B (Myc-DDK-tagged)-Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1 |
CNY 2400.00 |
|
RC213692L3 | Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC213692L4 | Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG213692 | SAR1B (tGFP-tagged) - Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1 |
CNY 4000.00 |