PPM1B (NM_001033557) Human Untagged Clone

CAT#: SC302727

PPM1B (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5



  "NM_001033557" in other vectors (4)

CNY 6180.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PPM1B mouse monoclonal antibody, clone OTI3C9 (formerly 3C9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PP2C-beta; PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001033557, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGAAT
GGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCACAC
ACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGAT
GGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCACT
ACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGGAA
AATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACTTT
TCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTTCA
CCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGA
CAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAATC
CAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTCGT
GCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTT
TCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCTTG
GCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAATCT
AGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTTTA
CACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCAAG
GTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGGTT
GAAGAGATTATGGAGAAGTCTGGCGAGGAAGGAATGCCTGATCTTGCCCATGTCATGCGC
ATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGCGT
AATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACATAGAGAAAGTGATGGGCAGAAA
TGA
Restriction Sites Please inquire     
ACCN NM_001033557
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001033557.1, NP_001028729.1
RefSeq Size 3056 bp
RefSeq ORF 1143 bp
Locus ID 5495
UniProt ID O75688
Protein Families Druggable Genome, Phosphatase, Stem cell - Pluripotency
Protein Pathways MAPK signaling pathway
Gene Summary The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (5) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...