DUSP28 (NM_001033575) Human Untagged Clone
CAT＃: SC302742
DUSP28 (untagged)-Human dual specificity phosphatase 28 (DUSP28)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DUSP26; VHP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302742 representing NM_001033575.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGACCGGCAGAAGCTGGGCGCCGCGGGGCCGCCTCGCCCGTACCTCCACCGTTGGTGCGCGTCGCG CCCTCACTCTTCCTCGGGAGCGCGCGAGCCGCGGGCGCGGAGGAGCAGCTGGCGCGCGCGGGAGTCACG CTGTGCGTCAACGTCTCCCGCCAGCAGCCCGGCCCGCGCGCGCCCGGCGTGGCAGAGCTGCGCGTGCCC GTGTTCGACGACCCGGCTGAGGACCTGCTGGCGCACCTGGAGCCCACGTGCGCCGCCATGGAGGCCGCG GTGCGCGCCGGCGGCGCCTGCCTAGTCTACTGCAAGAACGGCCGCAGCCGCTCGGCCGCCGTCTGCACC GCGTACCTCATGCGGCACCGCGGCCTCAGCCTGGCGAAGGCCTTCCAGATGGTGAAGAGCGCTCGCCCG GTAGCAGAACCGAACCCGGGCTTCTGGTCTCAGCTCCAGAAGTATGAGGAGGCCCTCCAGGCCCAGTCC TGCCTGCAGGGAGAGCCCCCAGCCTTAGGGTTGGGCCCTGAGGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001033575 |
| Insert Size | 531 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001033575.1 |
| RefSeq Size | 1555 bp |
| RefSeq ORF | 531 bp |
| Locus ID | 285193 |
| UniProt ID | Q4G0W2 |
| MW | 18.3 kDa |
| Gene Summary | Has phosphatase activity with the synthetic substrate 6,8-difluoro-4-methylumbelliferyl phosphate (in vitro) (PubMed:24531476, PubMed:29121083). Has almost no detectable activity with phosphotyrosine, even less activity with phosphothreonine and displays complete lack of activity with phosphoserine (PubMed:29121083). The poor activity with phosphotyrosine may be due to steric hindrance by bulky amino acid sidechains that obstruct access to the active site (PubMed:29121083).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206912 | DUSP28 (Myc-DDK-tagged)-Human dual specificity phosphatase 28 (DUSP28) |
CNY 2400.00 |
|
| RC206912L3 | Lenti ORF clone of Human dual specificity phosphatase 28 (DUSP28), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC206912L4 | Lenti ORF clone of Human dual specificity phosphatase 28 (DUSP28), mGFP tagged |
CNY 5890.00 |
|
| RG206912 | DUSP28 (tGFP-tagged) - Human dual specificity phosphatase 28 (DUSP28) |
CNY 4370.00 |
