SRA1 (NM_001035235) Human Untagged Clone

CAT#: SC302827

SRA1 (untagged)-Human steroid receptor RNA activator 1 (SRA1)



  "NM_001035235" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SRA1 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms pp7684; SRA; SRAP; STRAA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302827 representing NM_001035235.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGCGCTGCCCCGCTGGCCAAGCGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAG
GAACGCGGCTGGAACGACCCGCCGCAGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGC
TCGCTGCTTACCAAGAGGGTCGCCGCACCCCAGGATGGATCCCCCAGAGTCCCCGCATCAGAGACTTCT
CCTGGGCCTCCCCCAATGGGGCCTCCACCTCCTTCAAGTAAGGCTCCCAGGTCCCCACCTGTGGGGAGT
GGTCCTGCCTCTGGCGTGGAGCCCACAAGTTTCCCAGTCGAGTCTGAGGCTGTGATGGAGGATGTGCTG
AGACCTTTGGAACAGGCATTGGAAGACTGCCGTGGCCACACAAGGAAGCAGGTATGTGATGACATCAGC
CGACGCCTGGCACTGCTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATG
GCTCTACTGGTGCAAGAGCTTTCAAGCCACCGGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATG
GTTGACCATGTGACTGAGGTCAGTCAGTGGATGGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGT
CTGTTTTCAGAGGAGGCAGCCAATGAAGAGAAATCTGCAGCCACAGCTGAGAAGAACCATACCATACCA
GGCTTCCAGCAGGCTTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001035235
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001035235.3
RefSeq Size 1955 bp
RefSeq ORF 711 bp
Locus ID 10011
UniProt ID Q9HD15
MW 25.7 kDa
Gene Summary Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...