Caveolin 3 (CAV3) (NM_001234) Human Untagged Clone
CAT＃: SC302995
CAV3 (untagged)-Human caveolin 3 (CAV3), transcript variant 2
CNY 1200.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LGMD1C; LQT9; MPDT; RMD2; VIP-21; VIP21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001234 edited
GATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAA GGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGGA TTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGGT GAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGCT GGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACAT CTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACAT CTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCTG CAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAAAGCCAGGTGGGGCAACAGCGGTG GCAGGGCAGGGGGTGGTGGGCCAGACTGGTCCCCGGGGGACTTCTTCACAGGGGCTGCTG GCGAGCTCTTTCTCTTTAGGGACTGCTCCATACCCCATGATGGAGCACACGGTGTAGGGA AGCCAGAAAGAAAAGACGGCCCAGCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001234 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001234.3, NP_001225.1 |
| RefSeq Size | 1329 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 859 |
| UniProt ID | P56539 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Focal adhesion |
| Gene Summary | This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) is shorter than variant 1, since it lacks a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Cell Surface Expression of Human Ether-a-go-go-related Gene (hERG) Channels Is Regulated by Caveolin-3 Protein via the Ubiquitin Ligase Nedd4-2
,Jun Guo, Tingzhong Wang, Xian Li, Heidi Shallow, Tonghua Yang, Wentao Li, Jianmin Xu, Michael D. Fridman, Xiaolong Yang, and Shetuan Zhang,
J. Biol. Chem., Sep 2012; 287: 33132 - 33141.
[CAV3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210118 | CAV3 (Myc-DDK-tagged)-Human caveolin 3 (CAV3), transcript variant 2 |
CNY 1200.00 |
|
| RC210118L1 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC210118L2 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC210118L3 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC210118L4 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 2, mGFP tagged |
CNY 3600.00 |
|
| RG210118 | CAV3 (tGFP-tagged) - Human caveolin 3 (CAV3), transcript variant 2 |
CNY 2800.00 |
其它Caveolin 3产品
