CIDE A (CIDEA) (NM_001279) Human Untagged Clone
CAT#: SC302998
CIDEA (untagged)-Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CIDE-A |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001279 edited
CGCCATGGAGGCCGCCCGGGACTATGCAGGAGCCCTCATCAGGCCCCTGACATTTATGGG ATCACAGACTAAGCGAGTCCTGTTCACCCCGCTCATGCATCCAGCTCGCCCTTTCCGGGT CTCCAACCATGACAGGAGCAGCCGGCGTGGGGTGATGGCAAGCAGCCTGCAGGAGCTCAT CAGCAAGACTCTGGATGCCCTCGTCATCGCTACCGGACTGGTCACTCTGGTGCTGGAGGA AGATGGCACCGTGGTGGACACAGAAGAGTTCTTTCAGACCTTGGGAGACAACACGCATTT CATGATCTTGGAAAAAGGACAGAAGTGGATGCCGGGCAGCCAGCACGTCCCCACTTGCTC GCCGCCGAAGAGGTCGGGAATAGCGAGAGTCACCTTCGACTTGTACAGGCTGAACCCCAA GGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTA CGACATCCGGTGCACGGGACTCAAGGGCCTGCTGAGGAGTCTGCTGCGGTTCCTGTCCTA CTCCGCCCAGGTGACGGGACAGTTTCTCATCTATCTGGGCACATACATGCTCCGGGTGCT GGATGACAAGGAAGAGCGGCCATCCCTCCGGTCACAAGCCAAGGGCAGGTTCACGTGTGG ATAGGGATGCAGGCTGTCGCCGGCTCTTGAGCCAAACACTGTGTTTCGTTTGGCTCAATG ACGAATGTTGAAGATGCTTTTATGTTCTGAGCCACATGCACTTGGAGGCCGCTGGTCACG CTGCTCAGGAGTGGTGCCCAGAAAAGGAAAGGGCTTGGTGGTACATGAAGTGGGGGCAGT GGGCAGGGTGCCCTGGGGGGGAGGCATAGAGGGCCCTGGGGGTCATGGGAAGCGAGCACG CAGCAGGCGTGCCCAGGAGCGTGTGCATGTGTCAGAGCCATTTGGTCCATCATCTCCTGC AATAAACCCATCGCAAGAATGACCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001279 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a good match to NM_001279.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001279.2, NP_001270.1 |
| RefSeq Size | 996 bp |
| RefSeq ORF | 660 bp |
| Locus ID | 1149 |
| UniProt ID | O60543 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) encodes the shorter isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219669 | CIDEA (Myc-DDK-tagged)-Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1 |
CNY 2400.00 |
|
| RC219669L3 | Lenti ORF clone of Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219669L4 | Lenti ORF clone of Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG219669 | CIDEA (tGFP-tagged) - Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1 |
CNY 4370.00 |
