CIDE A (CIDEA) (NM_001279) Human Untagged Clone

CAT#: SC302998

CIDEA (untagged)-Human cell death-inducing DFFA-like effector a (CIDEA), transcript variant 1



  "NM_001279" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal CIDE-A Antibody
    • 100 ug

CNY 5808.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CIDE-A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001279 edited
CGCCATGGAGGCCGCCCGGGACTATGCAGGAGCCCTCATCAGGCCCCTGACATTTATGGG
ATCACAGACTAAGCGAGTCCTGTTCACCCCGCTCATGCATCCAGCTCGCCCTTTCCGGGT
CTCCAACCATGACAGGAGCAGCCGGCGTGGGGTGATGGCAAGCAGCCTGCAGGAGCTCAT
CAGCAAGACTCTGGATGCCCTCGTCATCGCTACCGGACTGGTCACTCTGGTGCTGGAGGA
AGATGGCACCGTGGTGGACACAGAAGAGTTCTTTCAGACCTTGGGAGACAACACGCATTT
CATGATCTTGGAAAAAGGACAGAAGTGGATGCCGGGCAGCCAGCACGTCCCCACTTGCTC
GCCGCCGAAGAGGTCGGGAATAGCGAGAGTCACCTTCGACTTGTACAGGCTGAACCCCAA
GGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTA
CGACATCCGGTGCACGGGACTCAAGGGCCTGCTGAGGAGTCTGCTGCGGTTCCTGTCCTA
CTCCGCCCAGGTGACGGGACAGTTTCTCATCTATCTGGGCACATACATGCTCCGGGTGCT
GGATGACAAGGAAGAGCGGCCATCCCTCCGGTCACAAGCCAAGGGCAGGTTCACGTGTGG
ATAGGGATGCAGGCTGTCGCCGGCTCTTGAGCCAAACACTGTGTTTCGTTTGGCTCAATG
ACGAATGTTGAAGATGCTTTTATGTTCTGAGCCACATGCACTTGGAGGCCGCTGGTCACG
CTGCTCAGGAGTGGTGCCCAGAAAAGGAAAGGGCTTGGTGGTACATGAAGTGGGGGCAGT
GGGCAGGGTGCCCTGGGGGGGAGGCATAGAGGGCCCTGGGGGTCATGGGAAGCGAGCACG
CAGCAGGCGTGCCCAGGAGCGTGTGCATGTGTCAGAGCCATTTGGTCCATCATCTCCTGC
AATAAACCCATCGCAAGAATGACCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001279
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a good match to NM_001279.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001279.2, NP_001270.1
RefSeq Size 996 bp
RefSeq ORF 660 bp
Locus ID 1149
UniProt ID O60543
Protein Families Druggable Genome
Gene Summary This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (1) encodes the shorter isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...