EREG (NM_001432) Human Untagged Clone
CAT#: SC303018
EREG (untagged)-Human epiregulin (EREG)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Ep; EPR; ER |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001432 edited
ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTC TGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATC CCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTG GCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAG TGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGT GTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAATATGTGGCT TTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTC TGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACC TCAGGGGATCCAGAGTTGCCGCAAGTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001432 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001432.1, NP_001423.1 |
RefSeq Size | 4627 bp |
RefSeq ORF | 510 bp |
Locus ID | 2069 |
UniProt ID | O14944 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | ErbB signaling pathway |
Gene Summary | This gene encodes a secreted peptide hormone and member of the epidermal growth factor (EGF) family of proteins. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and the structurally related erb-b2 receptor tyrosine kinase 4 (ERBB4). The encoded protein may be involved in a wide range of biological processes including inflammation, wound healing, oocyte maturation, and cell proliferation. Additionally, the encoded protein may promote the progression of cancers of various human tissues. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218706 | EREG (Myc-DDK-tagged)-Human epiregulin (EREG) |
CNY 2400.00 |
|
RC218706L1 | Lenti ORF clone of Human epiregulin (EREG), Myc-DDK-tagged |
CNY 4800.00 |
|
RC218706L2 | Lenti ORF clone of Human epiregulin (EREG), mGFP tagged |
CNY 5890.00 |
|
RC218706L3 | Lenti ORF clone of Human epiregulin (EREG), Myc-DDK-tagged |
CNY 4800.00 |
|
RC218706L4 | Lenti ORF clone of Human epiregulin (EREG), mGFP tagged |
CNY 4800.00 |
|
RG218706 | EREG (tGFP-tagged) - Human epiregulin (EREG) |
CNY 4000.00 |