GAGE1 (NM_001468) Human Untagged Clone
CAT#: SC303028
GAGE1 (untagged)-Human G antigen 1 (GAGE1), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT4.1; GAGE-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001468, the custom clone sequence may differ by one or more nucleotides
ATGAGTTGGCGAGGAAGATCGACCTATTATTGGCCTAGACCAAGGCGCTATGTACAGCCTCCTGAAATGA TTGGGCCTATGCGGCCCGAGCAGTTCAGTGATGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCAGC AACTCAACGTCAGGATCCTGCAGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGGCCG AAGCCTGAAGCTGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGTCCTGATG GGCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGAGATGAGGTCTCACTATGT TGCCCAGACTGGGATTCTCTGGCTTTTAATGAACAATTGCTTCTTAAATCTTTCCCCACGGAAACCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001468 |
Insert Size | 3100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001468.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001468.1, NP_001459.1 |
RefSeq Size | 646 bp |
RefSeq ORF | 417 bp |
Locus ID | 2543 |
Gene Summary | This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YRPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. Nothing is presently known about the function of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206299 | GAGE1 (Myc-DDK-tagged)-Human G antigen 1 (GAGE1), transcript variant 1 |
CNY 1200.00 |
|
RC206299L3 | Lenti ORF clone of Human G antigen 1 (GAGE1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC206299L4 | Lenti ORF clone of Human G antigen 1 (GAGE1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG206299 | GAGE1 (tGFP-tagged) - Human G antigen 1 (GAGE1), transcript variant 1 |
CNY 2800.00 |
|
SC317240 | GAGE1 (untagged)-Human G antigen 1 (GAGE1), transcript variant 1 |
CNY 3990.00 |