GALR1 (NM_001480) Human Untagged Clone
CAT#: SC303029
GALR1 (untagged)-Human galanin receptor 1 (GALR1)
CNY 3656.00
CNY 5700.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GALNR; GALNR1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001480 edited
ATGGAGCTGGCGGTCGGGAACCTCAGCGAGGGCAACGCGAGCTGGCCGGAGCCCCCCGCC CCGGAGCCCGGGCCGCTGTTCGGCATCGGCGTGGAGAACTTCGTCACGCTGGTGGTGTTC GGCCTGATCTTCGCGCTGGGCGTGCTGGGCAACAGCCTAGTGATCACCGTGCTGGCGCGC AGCAAGCCGGGCAAGCCGCGGAGCACCACCAACCTGTTCATCCTCAACCTGAGCATCGCC GACCTGGCCTACCTGCTCTTCTGCATCCCCTTCCAGGCCACCGTGTACGCGCTGCCCACC TGGGTGCTGGGCGCCTTCATCTGCAAGTTCATCCACTACTTCTTCACCGTGTCCATGCTG GTGAGCATCTTCACCCTGGCCGCGATGTCCGTGGACCGCTACGTGGCCATCGTGCACTCG CGGCGCTCCTCCTCCCTCAGGGTGTCCCGCAACGCGCTGCTGGGCGTGGGCTGCATCTGG GCGCTGTCCATTGCCATGGCCTCGCCCGTGGCCTACCACCAGGGCCTCTTCCACCCGCGC GCCAGCAACCAGACCTTCTGCTGGGAGCAGTGGCCCGACCCTCGCCACAAGAAGGCCTAC GTGGTGTGCACCTTCGTCTTCGGCTACCTGCTGCCGCTCCTGCTCATCTGCTTCTGCTAT GCCAAGGTCCTTAATCACTTGCATAAAAAGTTGAAGAACATGTCAAAGAAGTCTGAAGCA TCCAAGAAAAAGACTGCACAGACAGTTCTGGTGGTGGTTGTGGTGTTTGGAATCTCCTGG CTGCCGCACCACATCATCCATCTCTGGGCTGAGTTTGGAGTTTTCCCGCTGACGCCGGCT TCCTTCCTCTTCAGAATCACCGCCCACTGCCTGGCGTACAGCAATTCCTCCGTGAATCCT ATCATTTATGCATTTCTCTCTGAAAATTTCAGGAAGGCCTATAAACAAGTGTTCAAGTGT CACATTCGCAAAGATTCACACCTGAGTGATACTAAAGAAAATAAAAGTCGAATAGACACC CCACCATCAACCAATTGTACTCATGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001480 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001480.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001480.2, NP_001471.1 |
| RefSeq Size | 3056 bp |
| RefSeq ORF | 1050 bp |
| Locus ID | 2587 |
| UniProt ID | P47211 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Neuroactive ligand-receptor interaction |
| Gene Summary | The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213471 | GALR1 (Myc-DDK-tagged)-Human galanin receptor 1 (GALR1) |
CNY 3656.00 |
|
| RC213471L3 | Lenti ORF clone of Human galanin receptor 1 (GALR1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213471L4 | Lenti ORF clone of Human galanin receptor 1 (GALR1), mGFP tagged |
CNY 5890.00 |
|
| RG213471 | GALR1 (tGFP-tagged) - Human galanin receptor 1 (GALR1) |
CNY 5256.00 |
