beta Casein (CSN2) (NM_001891) Human Untagged Clone
CAT#: SC303092
CSN2 (untagged)-Human casein beta (CSN2)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CASB; PDC213 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001891 edited
ATGAAGGTCCTCATCCTCGCCTGCCTGGTGGCTCTTGCTCTTGCAAGGGAGACCATAGAA AGCCTTTCAAGCAGTGAGGAATCTATTACAGAATACAAGCAGAAAGTTGAGAAGGTTAAA CATGAGGACCAGCAGCAAGGAGAGGATGAACACCAGGATAAAATCTACCCCTCTTTCCAG CCACAGCCTCTGATCTATCCATTCGTTGAACCTATCCCCTATGGTTTTCTTCCACAAAAC ATTCTGCCTCTTGCTCAGCCTGCTGTGGTGCTGCCTGTCCCTCAGCCTGAAATAATGGAA GTCCCTAAAGCTAAAGACACTGTCTACACTAAGGGCAGAGTGATGCCTGTCCTTAAATCT CCAACGATACCCTTTTTTGACCCTCAAATCCCAAAACTCACTGATCTTGAAAATCTGCAT CTTCCTCTGCCTCTGCTCCAGCCCTTGATGCAGCAGGTCCCTCAGCCTATTCCTCAGACT CTTGCACTTCCCCCTCAGCCCCTGTGGTCTGTTCCTCAGCCCAAAGTCCTGCCTATCCCC CAGCAAGTGGTGCCCTACCCTCAGAGAGCTGTGCCTGTTCAAGCCCTTCTGCTCAACCAA GAACTTCTACTTAACCCCACCCACCAGATCTACCCTGTGACTCAGCCACTTGCCCCAGTT CATAACCCCATTAGTGTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001891 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001891.1, NP_001882.1 |
RefSeq Size | 1065 bp |
RefSeq ORF | 681 bp |
Locus ID | 1447 |
UniProt ID | P05814 |
Protein Families | Secreted Protein |
Gene Summary | This gene is a member of the beta casein family. There are two types of casein protein, beta (encoded by this gene) and kappa, both of which are secreted in human milk. Beta casein is the principal protein in human milk and the primary source of essential amino acids for a suckling infant. Beta and kappa casein proteins acting together form spherical micelles which bind within them important dietary minerals, such as calcium and phosphorous. In addition, the C-terminal 14 aa of the protein has antimicrobial activity, especially in preterm milk, displaying antibacterial activity against S. aureus and Y. enterocolitica. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223777 | CSN2 (Myc-DDK-tagged)-Human casein beta (CSN2) |
CNY 2400.00 |
|
RC223777L3 | Lenti ORF clone of Human casein beta (CSN2), Myc-DDK-tagged |
CNY 4800.00 |
|
RC223777L4 | Lenti ORF clone of Human casein beta (CSN2), mGFP tagged |
CNY 5890.00 |
|
RG223777 | CSN2 (tGFP-tagged) - Human casein beta (CSN2) |
CNY 4000.00 |
其它beta Casein产品