GCAP2 (GUCA1B) (NM_002098) Human Untagged Clone

CAT#: SC303119

GUCA1B (untagged)-Human guanylate cyclase activator 1B (retina) (GUCA1B)



  "NM_002098" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GUCA1B rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GCAP 2; GCAP2; GUCA2; RP48
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002098 edited
CTCAGGGCTAGCATGGGGCAGGAGTTTAGCTGGGAGGAGGCGGAGGCAGCTGGCGAGATA
GATGTGGCGGAGCTCCAGGAGTGGTACAAGAAGTTTGTGATGGAGTGCCCCAGCGGCACA
CTCTTTATGCATGAGTTTAAGCGCTTCTTCAAGGTCACAGACGATGAGGAGGCCTCCCAG
TATGTAGAGGGCATGTTCCGAGCCTTCGACAAGAATGGGGACAACACCATCGACTTCCTG
GAGTACGTGGCAGCTCTGAATCTCGTGCTGAGGGGCACCCTGGAGCACAAGCTGAAGTGG
ACATTCAAGATCTATGATAAGGATGGCAATGGCTGCATCGACCGCCTGGAGCTACTCAAC
ATTGTGGAGGGAATTTACCAGCTGAAGAAAGCCTGCCGGCGAGAGCTACAAACTGAGCAA
GGCCAGCTGCTCACACCCGAGGAGGTCGTGGACAGGATCTTCCTCCTGGTGGATGAGAAT
GGAGATGGCCAGCTGTCTCTGAACGAGTTTGTTGAAGGTGCCCGTCGGGACAAGTGGGTG
ATGAAGATGCTGCAGATGGACATGAATCCCAGCAGCTGGCTCGCTCAGCAGAGACGGAAA
AGTGCCATGTTCTGA
Restriction Sites Please inquire     
ACCN NM_002098
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002098.3, NP_002089.3
RefSeq Size 2288 bp
RefSeq ORF 603 bp
Locus ID 2979
UniProt ID Q9UMX6
Protein Families Druggable Genome
Protein Pathways Olfactory transduction
Gene Summary The protein encoded by this gene is a calcium-binding protein that activates photoreceptor guanylate cyclases. This gene may have arisen due to a gene duplication event since there is a highly similar gene clustered with it on chromosome 6. Mutations in this gene can cause a form of retinitis pigmentosa. [provided by RefSeq, Nov 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...