KLRC3 (NM_002261) Human Untagged Clone

CAT#: SC303160

KLRC3 (untagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1



  "NM_002261" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KLRC3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NKG2-E; NKG2E
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002261 edited
CCACCATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGT
GGCAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATAT
TCCAAGTAGAATTAAACCTTCAAAATGCTTCTCTGAATCATCAAGGGATTGATAAAATAT
ATGACTGCCAAGGTTTACTGCCACCTCCAGAAAAGCTCACTGCCGAGGTCCTAGGAATCA
TTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGC
AGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGCCATTGTCCTG
AGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGG
AAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATG
AAGAAGAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTA
ACAGCAGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAG
ACTCAGATCATGCTGAACGTAACTGTGCAATGCTACATGTACGTGGACTTATATCAGACC
AGTGTGGATCTTCAAGAATCATTAGACGGGGTTTCATCATGTTGACCAGGCTGGTCTTGA
ACTCCTGAG
Restriction Sites Please inquire     
ACCN NM_002261
Insert Size 700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002261.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002261.2, NP_002252.2
RefSeq Size 1042 bp
RefSeq ORF 723 bp
Locus ID 3823
UniProt ID Q07444
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Natural killer cell mediated cytotoxicity
Gene Summary Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as NKG2-E, represents the longer transcript but encodes the shorter isoform (E).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...