LMO1 (NM_002315) Human Untagged Clone
CAT#: SC303178
LMO1 (untagged)-Human LIM domain only 1 (rhombotin 1) (LMO1)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RBTN1; RHOM1; TTG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303178 representing NM_002315.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGGTGCTGGACAAGGAGGACGGCGTGCCGATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGC TGTGCGGGCTGTAACCGCAAGATCAAGGACCGCTATCTGCTGAAGGCATTGGACAAGTACTGGCACGAA GACTGCCTCAAGTGTGCCTGCTGTGACTGCCGCCTGGGCGAGGTGGGCTCCACCCTCTACACCAAGGCC AACCTCATCCTGTGCCGACGCGACTACCTGAGGCTCTTTGGCACCACAGGGAACTGTGCTGCTTGCAGC AAGCTGATCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAACGTGTATCACCTCGACTGCTTCGCC TGCCAGCTCTGCAACCAGAGATTTTGTGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGT CAGATGGACTATGAGGAAGGGCAGCTCAATGGCACCTTTGAATCCCAAGTTCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002315 |
Insert Size | 471 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002315.2 |
RefSeq Size | 1315 bp |
RefSeq ORF | 471 bp |
Locus ID | 4004 |
UniProt ID | P25800 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 17.8 kDa |
Gene Summary | This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210233 | LMO1 (Myc-DDK-tagged)-Human LIM domain only 1 (rhombotin 1) (LMO1) |
CNY 1200.00 |
|
RC210233L3 | Lenti ORF clone of Human LIM domain only 1 (rhombotin 1) (LMO1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC210233L4 | Lenti ORF clone of Human LIM domain only 1 (rhombotin 1) (LMO1), mGFP tagged |
CNY 5890.00 |
|
RG210233 | LMO1 (tGFP-tagged) - Human LIM domain only 1 (rhombotin 1) (LMO1) |
CNY 2800.00 |