POU4F3 (NM_002700) Human Untagged Clone
CAT#: SC303236
POU4F3 (untagged)-Human POU class 4 homeobox 3 (POU4F3)
CNY 3656.00
CNY 7220.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BRN3C; DFNA15; DFNA42; DFNA52 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002700 edited
CGCTGAGCAGCGCTCACTTGGAGAGCGGCAAGCAAGCTAGACAAGCCTGATTCCATGTCA CCCGCTGCCACCCTGCCAGGAGCGCGAAGATGATGGCCATGAACTCCAAGCAGCCTTTCG GCATGCACCCGGTGCTGCAAGAACCCAAATTCTCCAGTCTGCACTCTGGCTCCGAGGCTA TGCGCCGAGTCTGTCTCCCAGCCCCGCAGCTGCAGGGTAATATATTTGGAAGCTTTGATG AGAGCCTGCTGGCACGCGCCGAAGCTCTGGCGGCGGTGGATATCGTCTCCCACGGCAAGA ACCATCCGTTCAAGCCCGACGCCACCTACCATACCATGAGCAGCGTGCCCTGCACGTCCA CTTCGTCCACCGTGCCCATCTCCCACCCAGCTGCGCTCACCTCACACCCTCACCACGCCG TGCACCAGGGCCTCGAAGGCGACCTGCTGGAGCACATCTCGCCCACGCTGAGTGTGAGCG GCCTGGGCGCTCCGGAACACTCGGTGATGCCCGCACAGATCCATCCACACCACCTGGGCG CCATGGGCCACCTGCACCAGGCCATGGGCATGAGTCACCCGCACACCGTGGCCCCTCATA GCGCCATGCCTGCATGCCTCAGCGACGTGGAGTCAGACCCGCGCGAGCTGGAAGCCTTCG CCGAGCGCTTCAAGCAGCGGCGCATCAAGCTGGGGGTGACCCAGGCGGACGTGGGCGCGG CTCTGGCTAATCTCAAGATCCCCGGCGTGGGCTCGCTGAGCCAAAGCACCATCTGCAGGT TCGAGTCTCTCACTCTCTCGCACAACAACATGATCGCTCTCAAGCCGGTGCTCCAGGCCT GGTTGGAGGAGGCCGAGGCCGCCTACCGAGAGAAGAACAGCAAGCCAGAGCTCTTCAACG GCAGCGAACGGAAGCGCAAACGCACGTCCATCGCGGCGCCGGAGAAGCGTTCACTCGAGG CCTATTTCGCTATCCAGCCACGTCCTTCATCTGAGAAGATCGCGGCCATCGCTGAGAAAC TGGACCTTAAAAAGAACGTGGTGAGAGTCTGGTTCTGCAACCAGAGACAGAAACAGAAAC GAATGAAGTATTCGGCTGTCCACTGATTGCGGCAGGGCGCAGCGTCGGGAGCCGGGAGAG CCTAGTGCTCATCCCTCCCGGGTTCGGGGGATGGTTATCGGG |
| Restriction Sites | Please inquire |
| ACCN | NM_002700 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002700.1, NP_002691.1 |
| RefSeq Size | 1017 bp |
| RefSeq ORF | 1017 bp |
| Locus ID | 5459 |
| UniProt ID | Q15319 |
| Protein Families | Transcription Factors |
| Gene Summary | This gene encodes a member of the POU-domain family of transcription factors. POU-domain proteins have been observed to play important roles in control of cell identity in several systems. This protein is found in the retina and may play a role in determining or maintaining the identities of a small subset of visual system neurons. Defects in this gene are the cause of non-syndromic sensorineural deafness autosomal dominant type 15. [provided by RefSeq, Mar 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211206 | POU4F3 (Myc-DDK-tagged)-Human POU class 4 homeobox 3 (POU4F3) |
CNY 3656.00 |
|
| RC211206L1 | Lenti ORF clone of Human POU class 4 homeobox 3 (POU4F3), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC211206L2 | Lenti ORF clone of Human POU class 4 homeobox 3 (POU4F3), mGFP tagged |
CNY 5890.00 |
|
| RC211206L3 | Lenti ORF clone of Human POU class 4 homeobox 3 (POU4F3), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211206L4 | Lenti ORF clone of Human POU class 4 homeobox 3 (POU4F3), mGFP tagged |
CNY 5890.00 |
|
| RG211206 | POU4F3 (tGFP-tagged) - Human POU class 4 homeobox 3 (POU4F3) |
CNY 5256.00 |
